A BLANK cell has a cell wall and a water vacuole to help maintain a rigid structure.


A. animal
B.plant
C bacteria




Answers

Answer 1
I think the answer is B) plant

Related Questions

What to do during study hall when you have no homework?

Answers

You can do your homework, search for a project you may have, read etc
You should try doing something that will affect your grade by going up
1.study
2.finsish any missing asinements
3.study for a test
4.finish anything that's due
I hope this helps.. :)

Which term means increasing the angle between two bones of the straightening of a limb?

Answers

extension- increasing the angle between two boned of the straightening of a limb

Tortoises with long necks were found to be abundant in regions that had vegetation on a higher level. A few years later, drought hit the region and the vegetation dried up. Over time, grasses were observed in the region. Shortly thereafter, an increase in short-necked tortoises was observed in the region. What does this change in the species of tortoises suggest?

Answers

Answer:

A.  

Changes in the environment give rise to evolution of species.

Explanation:

I just did this on PLATO and I got 100%

Final answer:

The change in the species of tortoises suggests natural selection, where tortoises with shorter necks became more abundant in a region with grasses after a drought.

Explanation:

This change in the species of tortoises suggests natural selection at play. In the given scenario, tortoises with long necks were more abundant in regions with higher-level vegetation. This is because their longer necks allowed them to reach and access more leaves for food. However, when a drought hit the region and the vegetation dried up, grasses started to grow. As a result, short-necked tortoises had an advantage as they could easily access the grasses. Over time, these short-necked tortoises became more prevalent in the region.

The client newly diagnosed with type 2 diabetes mellitus eats a lot of pasta products, such as macaroni and spaghetti. the client is 40 pounds (18 kg) overweight. the client asks the nurse if pasta can be included in the diabetic diet. what is the best response by the nurse?

Answers

The statement that the nurse best response in the client who has diagnose with type 2 diabetes mellitus eats a lot of pasta products is "Pasta can be a part of your diet. It's included in the bread and cereal exchange." So the nurse may say that pasta should be part of the client diet because it includes in the bread and cereal exchange.

As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
a. breathing
b. the nitrogen cycle
c. the water cycle
d. cellular respiration

Answers

D. Cellular Respiration

What is the basic structural unit of both dna and rna?

Answers

The Nucleotide. DNA and RNA are both nucleus acids. Nucleic acids' monomer is called a nucleotide.

The hard and brittle outer layer of the Earth is known as the _______. A. core B. lithosphere C. atmosphere D. mantle

Answers

Hi Ash, thanks for asking a question here on Brainly!

The hard and brittle outer layer of the Earth is known as the lithosphere.

Answer: Letter B 

Hope that helps! ★ If you have further questions about this question or need more help, feel free to comment below or post another question and send the link to me. -UnicornFudge aka Nadia 

If ur doing studyisland the answer is (A) lithosphere

How can blimps be of use in scientific studies of the air?

Answers

Blimps are efficient vehicles for holding a wide range of scientific instrumentation at various altitudes that scientists can choose. They could measure barometric pressures, temperature, concentrations of specific chemicals using special equipment, humidity using hygrometers, et cetera. Blimps also could be used to track air currents since blimps drift as they are pushed by winds.

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Answers

dge78wdgqwe8fguefuqefioequf9be

There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.

What are restriction enzymes?

A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.

Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.

Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.

Learn more about restriction enzymes:

https://brainly.com/question/14953274

#SPJ6

The nurse is used to working on the postpartum floor taking care of women who have had normal vaginal births. today, however, the nurse has been assigned to help care for women who are less than 24 hours post cesarean birth. the nurse realizes that some areas will not be assessed. what would the nurse leave out of the client assessments

Answers

The answer is perineum, usually a woman who experiences cesarean birth does not have an episiotomy though seldom this may be the case. In addition, perineum is the area among the anus and the scrotum in the male and among the anus and the vulva the labial opening to the vagina in the female. An episiotomy is a surgical process to expand the outlet of the birth canal to ease delivery of the baby and evade a sharp rip of the perineum.

Your patient tells you he is a jehovah's witness. what should you do to show your support for his spiritual beliefs?

Answers

Get to know your patient, learn more about it. that will show that you support his/her believes.

Final answer:

To show support for a patient who is a Jehova's Witness, it is important to understand and respect their spiritual beliefs. Ask about their specific beliefs, align medical treatments with those beliefs, and provide relevant resources and connections.

Explanation:

If your patient identifies as a Jehova's Witness, it is important to respect and support their spiritual beliefs in your role as a healthcare provider. Here are some steps you can take to show your support:

Ask your patient about their specific beliefs and practices as a Jehova's Witness. This will help you understand their unique needs and preferences.Ensure that any medical treatments or procedures align with their religious beliefs. For example, Jehova's Witnesses may refuse blood transfusions due to religious reasons, so it is important to explore alternative treatment options.Provide resources and connect your patient with a medical team that has experience working with Jehova's Witnesses. This can help ensure that their spiritual beliefs are respected throughout their healthcare journey.

What has uekaryotik cells liver, virus, oak, lactobacillus?

Answers

Eukaryotic cells have chromosomes, a membrane-bound nucleus, and membrane-bound organelles, practically any living thing. Eukaryotic cells are also considered animal cells. 

It could be both liver and oak
It could also just be liver if it specifies eukaryotic animal cells. 

Approximately what percentage of roadside litter flies out of the back of pick-up trucks

Answers

Approximately 51% of roadside litter flies out of the back of pick up trucks.
According to the Texas department of Transportation, more than half of road side litters in Texas fly out of back of pick up trucks. The habit of putting litters at the back of the truck is considered to the same as throwing the litters out of the window and efforts are been made by the government to stop this type of littering.

Final answer:

The exact percentage of roadside litter that comes from pickup trucks is unspecified, but such littering contributes significantly to environmental pollution. Improper waste disposal, such as unsecured truck loads, exacerbates the issue of waste management and urban littering.

Explanation:

The percentage of roadside litter that flies out of the back of pickup trucks is not explicitly provided in the provided reference material. However, it is important to note that littering and improper disposal of waste contribute significantly to environmental pollution. Roadside litter, including plastic bags and fast food wrappers, often originates from various sources, and unsecured loads from vehicles are indeed a contributing factor.

According to a study from the Environmental Protection Agency (EPA), over 40 million tons of food waste were generated in 2017, indicating the scope of waste management issues. Also, much of the plastic waste that ends up in the ocean comes from riverine systems, with a significant percentage coming from just a few rivers mainly in Asia and Africa. Urban areas play a key role in plastic pollution due to the concentration of human activities and improper waste disposal practices, such as the littering of plastic bags referred to as 'roadside daisies' in South Africa.

While the question about pickup trucks is specific, the overall context of the environmental impact of polluting behaviors, such as littering and unsecured cargos, ties back to the broader themes of waste management, environmental conservation, and personal responsibility.

Which of the following is generally true of female bones in relationship to male bones?

They are typically larger.
They are typically longer.
They are typically smoother.
They are typically spotted.

Answers

The are actually smoother!
b becuse there female ..........hope it helps

similarities between outer planets and inner planets

Answers

the outer planets are big and cold but the inner planets have more warmth and in earths case LIFE

We have already talked about another class of chemicals that help send signals in the body – neurotransmitters. how are neurotransmitters and hormones similar and how are they different

Answers

Hormones are the chemical messengers of the endocrine system and are transported by blood to distal target cells.Neurotransmitters are the chemical messengers found in the nervous system that specifically do the transmission across the synaptic cleft, where the space exists between two axons.They both carry messages but belong to different systems of the body.

Final answer:

Neurotransmitters and hormones serve as chemical messengers in the body, with neurotransmitters traveling short distances for precise communication between neurons, while hormones travel longer distances through the circulatory system to reach target cells. Neural messages are likened to train travel, limited to nerve tracts, while hormonal communication is akin to car travel, reaching any cell via blood flow. Neural messages are faster, whereas hormonal messages can lead to enduring changes.

Explanation:

Neurotransmitters and hormones both serve as chemical messengers in the body. Neurotransmitters are used by neurons and travel short distances to bind with receptors on postsynaptic neurons, while hormones enter the circulatory system to travel longer distances to reach target cells and bind with specific receptors.

Neural messages are like traveling on a train, limited to existing nerve tracts, while hormonal communication is compared to traveling in a car, able to reach any cell receiving blood via the circulatory system. The speed of neural messages is faster due to the short distance traveled, while hormonal messages can result in long-lasting changes throughout the body.

Which statement best describes the population at point D? A.The carrying capacity has been reached. B.The population density is very low. C.The birthrate is very low. D.There is unlimited food and space.

Answers

I think it might be either A or B. Hope this helped. Have a great day! :D
A. The carrying capacity has been reached. 

As you can see from the graph that there is a red dotted line (Carry capacity) and at D. this has been met.

The antibody molecule is held together by ________ bonds.

Answers

It is the disulphide bond. 

A cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction. hints a cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction.
a. True
b. False

Answers

False

In order to happen sexual reproduction, the cells that origin gametes must have an even number of chromosomes. By crossing a tetraploid (4n) with a diploid (2n), the offspring would have a total number of 3 copies of each chromosome (2 from the tetraploid parent and 1 from the diploid parent), which when undergoing sexual reproduction would not allow meiosis to happen because the chromosomes could not be evenly divided to gamete cells.

Identify the medical term referring to a (head) cold:

Answers

The medical term referring to a head cold is coryza. The coryza occurs when an individual’s mucous membranes in their nasal cavity has a presence of inflammation in which will likely result into having a hay fever or causing a person to have a cold.

Final answer:

The medical term referring to a (head) cold is rhinorrhea, which is the excessive production of mucus in response to a viral infection. It is a common symptom of a cold and is often accompanied by sneezing, congestion, sore throat, and coughing.

Explanation:

The medical term referring to a (head) cold is rhinorrhea. Rhinorrhea is the medical term for a runny nose, which is a common symptom of a cold. It occurs when the nasal tissues produce excessive mucus in response to a viral infection. Other symptoms of a cold may include sneezing, congestion, sore throat, and coughing.

Learn more about Rhinorrhea here:

https://brainly.com/question/34319474

#SPJ6

Insulin is a(n) ________ that lowers blood sugar by allowing the body's cells to absorb glucose from the blood.

Answers

Is a hormone produced by the pancreas

Which set of body parts does every mollusk have?

Answers

Hello!

A mollusk is a snail in case you didn't know! Every single one has a foot, a Visceral Mass, and a head. A Visceral mass is like the body and it includes the organs.

I hope this helped!

I am, yours most sincerely,
SuperHelperThingy.

The body plan of a mollusk ordinarily comprised of a head region, a muscular foot, and a visceral mass of abdominal organs that are usually enclosed inside a dorsal shell. Each class holds some contrast on this primary plan.

The structure of the gastropod body is substantially comparable to the primary body plan of mollusks.

Most mollusks have a muscular foot for crawling or burrowing. Some mollusks also have a head with sense organs. The delicate body comprises lungs or gills to breath and digestive and generative parts, all surrounded by a covering like an organ known as the mantle.

How would earth's atmosphere change if plants stopped carrying out photosynthesis?

Answers

the plant would no longer put out oxygen, and the concentration of carbon.
the atmosphere would no longer have oxygen and carbon. 

Where is the youngest crust material found on Earth?

Answers

underwater mountain chains called also known as mid-ocean ridges

Answer:

At divergent boundaries in the middle of the ocean (mid-ocean ridges)

=)

The processes of endocytosis and exocytosis both require?

Answers

require cells to expend energy

Answer: Uses vesicles

The fitt principle is applied to physical activity and exercise. what does fitt represent

Answers

Frequency, Intensity, Time, and Type.
Final answer:

The FITT principle represents Frequency, Intensity, Time, and Type, which are guidelines for creating an effective physical exercise program to enhance physical fitness and good health.

Explanation:

The FITT principle is a set of guidelines that can help you structure a physical exercise program effectively. FITT stands for Frequency, Intensity, Time, and Type:

Frequency refers to how often you engage in physical activity or exercise.Intensity indicates how hard you exercise during a workout session.Time refers to the duration of each exercise session.Type means the kind of exercise you do to improve or maintain physical fitness and overall good health.

Employing the FITT principle helps ensure that the workouts you perform are balanced and cover all aspects necessary for a comprehensive fitness program. This can include a combination of cardiovascular exercises, strength training, and flexibility workouts.

The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.

Answers

Generally the ear, and more specifically the cochlea

The ear is composed of 3 parts namely:
 1. The outer ("external") ear, composed of the pinna and ear canal, 
 2. The middle ear, composed of tympanic cavity and three ossicles, 
 3. The inner ear, composed of semicircular canals, the utricle, saccule, and the cochlea. 

Hearing happens initially by allowing the pinna of your ear to focus the sound. Then, by means of the ear canal and the ossicles, the sound is sent to the fluid-filled eardrum, which begins to vibrate. The vibrations are sent to the snail-shell looking component of the inner ear called the cochlea. The cochlea senses these vibrations and converts them to nerve impulses to be interpreted by the brain, making you "hear" the sound. 




What is one major impact of seedless vascular plants?

Answers

By far the greatest impact of seedless vascular plants on human life, however, comes from their extinct progenitors. The tall club mosses, horsetails, and tree-like ferns that flourished in the swampy forests of the Carboniferous period gave rise to large deposits of coal throughout the world.

The vascular seedless plants are utilized as the medicinal plant and fertilizer.

Further Explanation:

The vascular plants are those plants that possess xylem and phloem for the transport of water and food respectively. Plants that have vascular system but are seedless are the members of Pteridophytes.

The characteristics of Pteridophytes:

1. They are seedless and vascular cryptogams: They reproduces through the production of spores.

2. They show alternation of generation as the sporophytic generation alternates with the gametophytic generation: Sporophyte possess true root, stem and leaves.

3. Spores are developed in the sporangia. Both type of spores are developed- homosporous and heterosporous.

4. Sex organs are multicellular and are jacketed.

Some of the example of Pteridophytes are:

1. Equisetum

2. Salvinia

3. Dicksonia

4. Selaginella

The importance of pteridophytes:

1. They are used as cattle feed

2. They are used for medicinal purpose. For example the foliage decoction of Lycopodium is utilized in homeopathy to treat certain disease such as constipation, eczema, diarrhea and inflammation of liver. Equisetumcontains various flavonoid and saponina that have diuretic effect.

3. Marsilea contains starch and are consumed by people as food in some areas.

4.  Aquatic pteridophyte such as Azollaare used as a very good biofertiliser.

Learn more:

1. Learn more about plant https://brainly.com/question/862697

2. Learn more about photosynthesis https://brainly.com/question/873199

3. Learn more about food https://brainly.com/question/1251757

Answer Details:

Grade: College Biology

Subject: Biology

Chapter: The Plant Kingdom

Keywords:

Vascular seedless, xylem, phloem, pteridophytes, sporophytic generation, gametophytic generation, Lycopodium, Marsilea, Azolla.

A female client presents to the health care provider's office with increasing stomach acidity. she self-administers calcium antacids. she notes that she seems to be having more issues with stomach acid, so she has been taking the calcium antacids more frequently. the nurse suspects that this may have caused what to occur in this client?

Answers

The nurse suspected that the client who seems to be having an issue with stomach acid, may have cause to what occur to the client is rebound acidity. Rebound acidity is an increase in gastric acid secretion basal or stimulated above pre-treatment levels following discontinuation of anti-secretory therapy.

According to thelen (1986), which reflex may contribute to the birthing process? the stepping reflex the rooting reflex the grasping reflex. the startle reflex.

Answers

According to Thelen {1986}, THE STEPPING REFLEX may contribute to the birthing process.
Stepping reflex is one of the reflexes demonstrate by new born babies. When resistance is exerted on the feet of a new born baby, the baby will respond by placing one foot in front of the other, this is called stepping reflex and Thelen suggested that this reflex may help in the birthing process.

The correct reflex that may contribute to the birthing process according to Thelen (1986) is the stepping reflex.

Thelen (1986) discussed the role of neonatal reflexes in the context of development and their potential functions. Among these reflexes, the stepping reflex is particularly interesting because it can be observed when a newborn is held upright with their feet touching a solid surface; the baby will make stepping movements. This reflex is thought to be a vestige of our evolutionary past, where it might have helped the infant to crawl and find the nipple to suckle shortly after birth.

While the stepping reflex is not directly involved in the process of birth itself, it is a reflex that emerges immediately after birth and could theoretically aid the infant in moving towards the mother's breast for feeding, which is an important aspect of the postnatal period. The other reflexes mentioned serve different purposes:

- The rooting reflex helps the baby find the nipple when the cheek is stroked.

- The grasping reflex occurs when the palm is stroked, causing the baby to grasp firmly.

- The startle reflex, also known as the Moro reflex, is a response to loud noises or the sensation of falling, where the baby throws out their arms and then pulls them back in.

Other Questions
This passage is based mainly on the ideas of which enlightenment thinker? What is the opportunity cost in this scenario? Mikael has saved $4,000 for his trip to Brazil. He has calculated that his total transportation expenses will be $1,000. The hotel will cost him another $1,500. He will spend about $500 on food. He plans on spending the remaining $1,000 for sight seeing and buying souvenirs. While booking his plane ticket, he realizes that the price has gone up. His total transportation expenses will go up by $200. He realizes that he cannot cancel his hotel reservation. He also doesn't want to go cheap on food. Finally, he decides to give up visiting popular Ouro Preto during his stay in brazil. A) Transportation B)Hotel C)Food D)Sightseeing In an atom, the electrons orbiting around the nucleus have what kind of a charge For the complete redox reactions given here write the half-reactions and identify Kevin has $4.85 in nickels and dimes. If he has 34 fewer dimes than nickels, how many coins (nickels and dimes) does he have altogether? A.) 74 coins B.) 75 coinsC.) 76 coins D.) 77 coins Which of the following was the primary complaint the colonies had against the various acts passed by Great Britain?the colonies had no representation in Britain's legislaturethe acts limited free tradethe colonies could not afford to pay the taxesthe acts increased military brutality toward the colonists A card is drawn from a deck of 52 cards. find the probability of drawing a king or a red card Select all that apply. Recognizing patterns helps you to _____. avoid making mistakes in the future make sure history always repeats itself understand human nature and behavior know there is no way to predict the future which type of satire uses lighthearted humor to criticize something? Pizza World has a specialty cheese pizza that can be cut into 10 slices, and they have a specialty pepperoni pizza that can be cut into 16 slices. If Pizza World serves combos of one slice of cheese and one slice of pepperoni pizza with no slices left over, what is the smallest number of combos that Pizza World can prepare? What is the main function of the Golgi complex (apparatus) The population of bees has been decreasing at a rate of 10% per year in 2012 there were 6000 bees in particular hive how many bees were there in 2014 Fatema loves to run marathons. The last one she participated in took her 2 hours to complete. The year before (2016) , she completed the same marathon in 8/11 of the time and the year before that (2015) she completed it in 9/12 of the time. What year did Fatema run the fastest? JUSTIFY YOUR ANSWER PLEASE I NEED HELP ASAP! Every work of art is aesthetically pleasing and has organic unity. treu or false 163water bottles in 9 cases= the music for Alyssa's dance routine last exactly 4 min. when she dances her routine, she starts with her music and finishes 12 seconds before the music ends. what percent of the time the music is playing is Alyssa dancing. A ticket agency charges 9.5% fee on all tickets sold .if a ticket cost 40$ what is the fee My number has 2 hundreds. The tens digit is 9 more than the ones digit Which of the following is equal to 2.0 liters? 200 mL 2,000 cm3 20 m3 20,000 mm3 Find the diameter of a cone that has a volume of 56.52 cubic inches and a height of 6 inches. use 3.14 for pi. (1 point) 3 inches 6 inches 9 inches 12 inches Steam Workshop Downloader