Assembling a complete sequence from fragment sequences
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?
Enter the complete DNA sequence, which should contain 24 bases.

Answers

Answer 1

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.


Related Questions

Two individuals both have depression, but they have experienced different genetic predispositions, different levels of self-esteem, and different affiliations with peers that have led to the depression. This is an example of____________.

Answers

Final answer:

content loaded

Two individuals both have depression, but they have experienced different genetic predispositions, different levels of self-esteem, and different affiliations with peers that have led to the depression. This is an example of differential susceptibility.

Explanation:

This example illustrates the concept of differential susceptibility, which suggests that genetic factors create varying degrees of responsiveness to environmental experiences in the development of conditions like depression. Two individuals with depression may have different genetic predispositions, levels of self-esteem, and social interactions, all of which can influence their susceptibility to depression. The interaction of these factors is key to understanding why even similar stressful life events can lead to different outcomes. Caspi et al. (2003) found that variations in the 5-HTTLPR gene, which influences serotonin levels, can make an individual more or less likely to develop depression after experiencing stressful events. This interaction between genetic makeup and environmental factors, known in part as the diathesis-stress model, explains why individuals have distinct experiences with depression.

When natural sources of ionizing radiation become increased because of accidental or deliberate human actions such as mining, they are referred to as _____ sources.

Answers

The question is incomplete as it does not have the options which are:

artificial

enhanced natural

extraterrestrial

manmade

Answer:

Enhanced natural resources

Explanation:

Natural resources are the resources used by the humans for survival present in the environment or provided by the surrounding environment.The natural resources includes the wood, gas, air, water and other substances.

The substances which emits harmful radiations like radium, thorium, uranium are known as radioactive isotopes.

When these ionizing radiation emitting natural substances increases in the environment due to human activities like the particle accelerators, X-rays and other methods which produces these substances then these substances are refereed to as the enhanced natural substances.

Thus, Enhanced natural resources is the correct answer.

Like DNA, RNA is a long string of nucleotides encased in a large molecule. However, there are three aspects of its structure that makes it different from DNA. What are these aspects? (Select all that apply.)You Selected:RNA is a single-stranded molecule.The sugar in each nucleotide of RNA is ribose.RNA’s thymine base is replaced by urcil

Answers

Answer:

All of the listed aspects are correct

Explanation:

Deoxyribosenucleic acid and Ribosenucleic acid are the two nucleic acids. They are polymers made up of nucleotide monomers. Both DNA are composed of

sequence of nucleotides but they have three main structural differences. They are:

1. Unlike DNA that has a double-helical structure formed by the hydrogen bonds that link two complementary nucleotide bases, the RNA is a composed of nucleotide sequence in a single shorter strand.

2. In the RNA molecule, one of the components that makes up its building block (nucleotide) is a five-carbon sugar called Ribose. In the DNA molecule, one oxygen atom is deficient in the sugar, hence the sugar in the DNA is called Deoxyribose.

3. Another component of the nucleotide that makes up the RNA and DNA structure are the nitrogenous bases, which are four in number viz: Adenine, Guanine, Cytosine and either Thymine or Uracil depending on the nucleic acid. Thymine only occurs in DNA while Uracil only occurs in the RNA molecule.

Cancer is a multistep process usually occurring over many years. The first step in the initiation process is thought to be caused by_________.

Answers

Answer:

Answer is genetic mutation in the growth regulatory genes.

Explanation:

Cancer is a disease cause by accumulated damage occurring to genes or continuous division of abnormal cells in the body. This may occur due to exposure to substances that are cancerous.

It can be be treated by a method known as chemotherapy.

There are some food items that can lower the risk of cancer in the body. These include berries, nuts, carrots , broccoli among others.

Note that cancer can spread to other parts of the body through lymph system and blood.

Who would have been MOST likely to claim that a slight protrusion in a certain region of someone's skull would indicate that the individual had an optimistic personality?A. AristotleB. Santiago Ramón y CajalC. William JamesD. Franz Gall

Answers

Answer:

D. Franz Gall

Explanation:

Franz Gall was a German neuroanatomist and a physiologist. He began the study of the localization of mental functions in the brain.

Claimed the founder of PHRENOLOGY, i.e., the measurement of bumps on the skull to predict mental traits and personality.

Gall came with the idea that a someone's personality could be determined by the shape of their skull. So a slight protrusion in a certain region of someone's skull, changing the shape of it, would indicate that the individual had an optimistic personality.

Phagocytes utilize all of the following to optimize interaction with (getting to and getting hold of) microorganisms EXCEPT1. lysozyme.2. complement.3. chemotaxis.4. opsonization.5. trapping a bacterium against a rough surface.

Answers

Final answer:

The method not used by phagocytes to optimize interaction with microorganisms is lysozyme. Phagocytes employ chemotaxis and opsonization to locate and bind to pathogens, while lysozyme acts to degrade bacterial cell walls post-engulfment.

Explanation:

Phagocytes utilize various mechanisms to optimize interactions with microorganisms for the purpose of defending the body against infections. Among the methods they use are chemotaxis, where complement proteins such as C3a and C4a serve as chemoattractants that draw phagocytes to the infected area. Moreover, opsonization enhances the attachment of microbes to phagocytes through antibody molecules like IgG, complement proteins C3b and C4b, and other acute phase proteins, making it easier for phagocytes to engulf them.

Phagocytes such as macrophages and neutrophils are capable of intracellular and extracellular killing of microorganisms. When a microbe is engulfed, it is enclosed in a vesicle known as a phagosome, which fuses with a lysozyme-filled lysosome where the pathogen is destroyed. However, lysozyme alone isn't used by phagocytes to optimize interaction with or hold onto microorganisms—it serves rather to degrade peptidoglycan in the bacterial cell wall.

Therefore, the correct answer to the question of which method is NOT used by phagocytes to optimize interaction with microorganisms is lysozyme. It is involved in the degradation of bacteria, not in the process leading up to phagocytosis.

Minerals cana. be degraded by the body. b. provide energy. c. become part of the body structural systems. d. be destroyed during cooking.

Answers

Answer:

The correct answer is c. become part of the body structural systems.

Explanation:

The body requires many minerals which are called essential minerals. Minerals are important in proper body growth and development. They can become a part of body structural system, for example, calcium and phosphorus are the minerals which are required to form bones and teeth.

Some minerals help in signal transmission through nerves, for example, sodium and potassium. Some minerals are an important part of hormone for example iodine which is used to make thyroid hormone. Therefore the correct answer is c.

Plant growth is affected by environmental factors such as gravity. If a seed is allowed to sprout and grow while it is turned sideways, which will most likely occur?

Answers

The determining conditions of the medium are: Sufficient supply of water, oxygen, and appropriate temperature. Each species prefers to germinate a certain temperature; In general, extreme cold or heat conditions do not favor germination.
Temperature is a decisive factor in the germination process, since it influences the enzymes that regulate the speed of biochemical reactions that occur in the seed after rehydration. ... Therefore, the seeds only germinate within a certain temperature range.

If a seed is allowed to sprout and grow while it is turned sideways, roots will grow downward, stems will grow upward.

TROPISM:

Tropism refers to the movement of an organism or part of an organism in response to stimuli. Tropism can either be negative or positive.

Positive tropism refers to movement in the direction of the stimulus while negative tropism refers to movement away from the direction of the stimulus.

In a plant, the stems are known to respond away from gravity i.e. they are negatively geotropic while the roots grow in the direction of gravity i.e. positively geotropic.

Therefore, If a seed is allowed to sprout and grow while it is turned sideways, roots will grow downward, stems will grow upward.

Learn more at: https://brainly.com/question/18937505?referrer=searchResults

Most traits are governed by a combination of gene pairs rather than a single pair of genes. this is called __________.

Answers

Answer:

Polygenic inheritance

Explanation:

In polygenic inheritance, one characteristic or trait is controlled by a combination of two or more than two genes. As several genes control a trait in a polygenic trait therefore there are many possible phenotype is possible in this situation.

In humans, examples of polygenic traits are eye color, hair color, skin color, height, body shape, body weight, etc. There is equal influence of gene which are contributing to a trait in polygenic inheritance. So complete dominance is not seen in polygenic traits. Therefore the correct answer is polygenic inheritance.

Most traits are governed by a combination of gene pairs rather than a single pair of genes. This is called polygenic inheritance.

Polygenic traits often display a wide range of phenotypic variation due to the cumulative effects of multiple genes. Each gene involved typically has a small effect on the trait.

The combined effects of these genes result in a continuous spectrum of possible trait variations, leading to a bell-shaped distribution when plotted, often resembling a normal distribution or bell curve.

Furthermore, environmental factors can also influence the expression of polygenic traits, adding an additional layer of complexity.

The interaction between genetic factors and the environment can significantly influence the final phenotype.

Understanding polygenic inheritance is vital in various fields, including genetics, medicine, agriculture, and evolutionary biology.

Traits like human height, skin color, susceptibility to certain diseases, and intelligence are examples of polygenic traits.

These traits result from the combined influence of multiple genes and environmental factors, making them challenging to study and predict accurately.

Advancements in genetic research and technologies like genome-wide association studies (GWAS) have enabled a better understanding of polygenic inheritance, shedding light on the genetic basis of complex traits and diseases, which is crucial for developing targeted treatments and interventions.

For such a more question on gene

https://brainly.com/question/1480756

#SPJ3

Imagine that you have found the remnants of a robin's egg on the ground. From your biology course, you know that this eggshell is composed of calcium. What else can be said of this eggshell?

Answers

Answer:

The birds are oviparous in nature and produces eggs that are hatched later by the parent. the egg hatching require proper heat and protection from the external enemy.

The egg shell is the hard covering of the egg of the bird that is made of the calcium. The egg shell protect the egg from the external environment. The calcium layer for the egg shell formation is obtained by the oseteoclast property of the cells.

. Complete the below sentences using: catalyst, intolerance, lactose, chemical reaction, reused, lactase
The enzyme ??? breaks down the sugar ???.
If the body doesn’t produce much of this enzyme, people have what’s called lactose ???.
During the ???? the enzyme doesn’t get used up, but gets ???
Enzymes are substances that speed up chemical reactions which are also known as ???

Answers

Answer:

The sentences can be completed as follows:

The enzyme lactase breaks down the sugar lactose.

If the body doesn’t produce much of this enzyme, people have what’s called lactose intolerance.

During the chemical reaction the enzyme doesn’t get used up, but gets reused.

Enzymes are substances that speed up chemical reactions which are also known as catalysts.

Explanation:

Enzymes can be described as molecules which act as biological catalysts i.e they are involved in speeding up a chemical reaction. The enzymes do not get used up in a chemical reaction and hence, they can be reused.

Lactase is an enzyme which helps in breaking down the sugar lactose which is commonly found in the milk. If enough lactase is not produced by a person's body, then he/she becomes unable to digest the sugar lactose. Such a condition is known as lactose intolerance.

________ is a process in which mitochondria formed when bacteria taken into a host cell gained nutrients and shelter, and the host cell gained ability to synthesize glucose

Answers

Answer:

Endosymbiosis

Explanation:

The endosymbiosis concept explains that the origin of membrane-bound organelles present in the eukaryotes occurred when some prokaryotic organisms started a symbiotic association with another prokaryote. Accordingly, mitochondria evolved when an anaerobic prokaryotic cell acquired aerobic bacteria as a symbiont. The symbiont lived inside the host cell and the host cell could form the process of aerobic cellular respiration. The purple bacteria are supposed to be the endosymbiont involved in the origin of mitochondria.

Final answer:

The process through which mitochondria are formed is called endosymbiosis. It is suggested that a host cell engulfed bacteria, which later evolved into mitochondria. The host cell and bacteria mutually benefited from this arrangement.

Explanation:

This process is called endosymbiosis, a key theory in biology that explains how structures such as mitochondria and chloroplasts evolved. The theory suggests that these organelles evolved from bacteria that were engulfed by a host cell. Over time, these bacteria became integrated into the cell and evolved into mitochondria. The host cell provided protection and nutrients to the bacteria, and in return, the bacteria helped the host cell synthesize glucose, an essential molecule for energy storage and transfer.

Learn more about Endosymbiosis here:

https://brainly.com/question/33444517

Ovoviviparous species are distinguished by what trait? Ovoviviparous species are distinguished by what trait? Offspring are nourished via a placenta prior to live birth. Offspring receive nourishment from the male parent. Offspring are nourished via the egg's yolk and then hatch from eggs. Offspring are nourished via the egg's yolk prior to live birth.

Answers

Answer: Offspring are nourished via the egg's yolk prior to live birth.

Explanation:

Ovoviviparous species are distinguished from other species like viviparous and oviparous, as offspring resulting from the fertilization of male sex cell and female sex cell because it

- grows in an egg shell, and derives nourishment from Egg's yolk

- are delivered out of their parents (as live birth) when eggs finally hatch inside their bodies

- occurs in very FEW animals like reptiles eg snakes

Answer: Offspring are nourished via the egg's yolk prior to live birth.

Explanation: After eggs are retained, they hatch in the female body and released live.

The nurse is providing discharge teaching for a client who suffered full-thickness burns. Which statement by the client demonstrates a need for further instruction on the rehabilitation phase of a burn injury?
1. "I should avoid using lotion to prevent infection."
2. "I should perform range-of-motion exercises daily."
3. "I will avoid direct sun exposure for at least 3 months."
4. "I will wear pressure garments to minimize scars."

Answers

Answer:

Option (1).

Explanation:

Burns are categorized into the different stages. The full thickness burns is also known as third stage burns that affect the skin badly and require the emergency hospitalization.

The oil layer can be applied on the loose burn area but lotion should be avoided on the severe burns as they cause different allergic reactions and may worse the burn skin. The sun exposure may excessive burns and exercise should be done for the motion of the burn part. The individuals should wear the tight clothes that can minimize the scars on the body.

Thus, the correct answer is option (1).

Answer:

The correct answer is - option 1.  

Explanation:

The nurse needs to demonstrate to provide instruction and rehabilitation phase of burn injury as the regarding to the prevention of infection, and exposure to make it severe by exposing or pressurizing the scars and many more. The correct statement would be the first statement as it helps to prevent the infection by touching the burn injury.

Thus, the correct answer is - option 1.

You are in a lab studying a newly discovered cell type. You observe a rigid cytoskeleton in this cell, along with a nucleus and a compartmentalized interior. How would you classify this cell?

Answers

Answer:

It will be classified as a possibly transitional cell from prokaryotic cell to eukaryotic cell.

Explanation:

The above classification was reached based on some facts.  The prokaryotes are single cell organism while some eukaryotes are single celled and some are multi celled.

The presence of nucleus and the compartmentalized interior in the cell are characteristics of an eukaryote, and these are lacking in the prokaryote.

The rigid cytoskeleton is found in the prokaryotic cell, and its lacking in the eukaryotic cell.

So , this create the assumption that the cell is possibly transitioning from prokaryotic cell to eukaryotic cell.

Final answer:

The cell observed with a nucleus and a compartmentalized interior, along with a rigid cytoskeleton, is a eukaryotic cell, characterized by its complex internal structure and organelles enclosed by lipid membranes.

Explanation:

Based on the description of the cell with a rigid cytoskeleton, a nucleus, and a compartmentalized interior, would be classified as a eukaryotic cell. Eukaryotic cells are known for their complex structures, which include internal compartments such as the nucleus and other organelles like vacuoles, all of which are enclosed by lipid membranes. Additionally, the presence of a clear cytoskeleton is a defining feature of eukaryotes, providing structural support and facilitating cellular functions such as motility and division.

A person who eats excessively and never seems to feel full may have which of the following conditions? a) Too much insulin b) Tumor in the hypothalamus c) Stomach bypass surgery d) Tumor in the hippocampus e) Too much of the hormone PYY.

Answers

Answer:

Tumor in the hypothalamus. (Ans. B)

Explanation:

Hypothalamus is known as the small part of the brain which is situated at the base of the brain. It's very small in structure but plays an important role in the human body such as:

1) Releasing hormones.

2) Body temperature regulation.

3) Managing sexual behavior.

4) Managing daily physiological cycles.

Hunger triggering hormone also released by the hypothalamus which is known as orexin. Tumor in the hypothalamus can trigger the secretion of orexin hormone which makes the person eats excessively and never seems to feel full.

Answer:

B) A tumor in the hypothalamus

Explanation:

Community constituencies of a local health department (lhd) include

Answers

the land mass in the geographic

region served by the LHD.

Which of the following documents must be given to every patient or patient's caregiver before administration of a vaccine
covered under the National Childhood Vaccine Injury Act (NCVIA)?

Answers

Answer:

Vaccine Information Statement (VIS)

Explanation:

Based on the information provided within the question it can be said that the document that must be given in these scenarios is the Vaccine Information Statement (VIS). This is a document made by the CDC that explains all the benefits and risks of a vaccine to vaccine recipients, and is mandatory that this document is provided to every patient or patient's caregiver/legal guardian before administering the vaccine.

Similarities between the DNA of certain bacteria and the DNA of both mitochondria and chloroplasts is evidence that these organelles originated as bacteria_____________-

Answers

Answer:

Bacteria Evolution

This process is called Endosymbiosis.

Explanation:

Symbiosis is a relationship in which organisms from two separate species live in a close, dependent relationship. Endosymbiosis (note that endo means within) is a specific type of symbiosis where one organism lives inside the other.

This causes bacteria, mitochondria, and chloroplasts to be similar in size. Bacteria also have DNA and ribosomes similar to those of mitochondria and chloroplasts.

Based on this and other evidence, scientists think host cells and bacteria formed endosymbiotic relationships long ago, when individual host cells took in aerobic (oxygen-using) and photosynthetic bacteria but did not destroy them. Through millions of years of evolution, the aerobic bacteria became mitochondria and the photosynthetic bacteria became chloroplasts.

What type of inheritance is shown in the pedigree?

a. sex linked dominant

b. sex linked recessive

c. autosomal dominant

d. autosomal recessive

Answers

Answer:

The answer is c. autosomal dominant

Explanation:

Distinction between dominant and recessive:

As evident from the pedigree, dominant traits never skip a generation. Recessive traits skip generations. If an affected individual has unaffected parents, the trait is recessive as one of them must be the carrier (heterozygous) but does not have the disease.  Therefore, considering all the above criteria, this is definitely a dominant trait.

Distinction between autosomal and X-linked Pedigrees:

Autosomal traits affect both males and females equally. X-linked recessive traits are more likely to affect males than females.X-linked dominant traits are more likely to affect females. But if a male is affected, all of his daughters will be affected but all his sons will be healthy.Considering above criteria, the trait is autosomal. Therefore, the pedigree represents an autosomal dominant trait.

The type of inheritance shown in the pedigree is c. autosomal dominant.

What is the type of inheritance shown in the pedigree?

In the given pedigree, the presence of the trait is observed in every generation, affecting both males and females. This suggests that the trait is not sex-linked.

Also, since the trait is present in individuals with affected parents, it indicates an autosomal pattern of inheritance. Furthermore, the trait is exhibited by individuals who have at least one affected parent, which is characteristic of autosomal dominant inheritance.

Read more about inheritance

brainly.com/question/15078897

#SPJ6

What is the difference between heterotrophs and autotrophs

Answers

Answer:

Autotrophs can make there own food but heterotrophs are dependent on other organisms for getting food.

Explanation:

Autotrophs are the organism that is capable of synthesizing their own food for example plants which makes their food by using sun energy by the process of photosynthesis.

Heterotrophs are the organisms that are not able to make their food on their own and are dependent on others for getting nutrition for example animals.  

Autotrophs are primary producers and heterotrophs are dependent on primary producers directly or indirectly to get nutrition.

The primary difference between autotrophs and heterotrophs lies in their methods of acquiring energy.

Autotrophs are capable of producing their own food through photosynthesis or chemosynthesis, typically using sunlight or inorganic chemical reactions to create organic compounds, whereas heterotrophs must consume other organisms or organic substances to obtain energy and the necessary nutrients for survival.

Autotrophs, such as plants and some bacteria, are fundamental to ecosystems as they synthesize organic molecules from simple inorganic substances like water and carbon dioxide. This process often involves photosynthesis, where sunlight is used, or chemosynthesis where chemical reactions are the energy source. This ability makes them the primary producers in food chains. On the other hand, heterotrophs, which include animals, fungi, and most bacteria, are consumers or decomposers that rely on the consumption of autotrophs (or other heterotrophs) for energy. They perform catabolism to break down complex organic molecules into simpler ones, releasing energy that is used for vital processes, including growth and reproduction. The relationship between these two groups is indispensable for the flow of energy within an ecosystem, positioning autotrophs at the base of the food web and heterotrophs at various levels above, depending on their diet.

When a person level of physical activity changes the circulatory system supplies body cell with amounts of nutrients and oxygen that are appropriate to sustain the new levy of activity. This statement illustrates the concept of

Answers

This statement illustrates the concept of Homeostasis.

Explanation:

When there exists an ability to balance between the internal factors and the external factors when there occurs a change in the environment is known as Homeostasis. It is the ability of balancing both the factors. It is present in human, plants and animals.

In human it is called as Homeostasis. and in animals and plants it is adaptation. This is very essential for the organisms to survive. Without this ability, all living organisms will face threat of death. Thus in the given statement the energy and the nutrients are supplied by the circulatory system in response to a change which is a physical exercise. thus it acts as an example of Homeostasis.

The correct concept illustrated by the statement is homeostasis.

Homeostasis is the ability of a living organism to maintain a stable internal environment despite changes in external conditions. When a person's level of physical activity changes, their body must adjust to meet the new demands for nutrients and oxygen by the cells. The circulatory system responds by increasing or decreasing the blood flow to various tissues, ensuring that cells receive the appropriate amounts of nutrients and oxygen to sustain the new level of activity. This is a classic example of homeostatic regulation, where the body's internal mechanisms work to maintain a balance, or homeostasis, in response to external stimuli or changes in physiological needs.

The circulatory system's response is mediated by several factors, including the release of hormones like adrenaline, changes in heart rate, and dilation or constriction of blood vessels. These adjustments ensure that tissues receive the necessary substances to perform at the required level of activity, whether it's increased during exercise or decreased during rest. This dynamic regulation is crucial for maintaining the body's overall equilibrium, which is the essence of homeostasis.

After an RNA molecule is transcribed from a eukaryotic gene, what is removed and what is spliced together to produce an mRNA molecule with a continuous coding sequence?a) operators; promoters. b) exons; introns. c) silencers; enhancers.
d) introns; exons. e) promoters; operators.

Answers

Answer:d)introns; exons

Explanation:Introns are the non-coding portion of the DNA. They do not code for a gene that can be expressed hence the need for them to be removed from the coding genes(Exons). The exons are then joined together after the introns have been removed to create a sequence of amino acids.

Herpes zoster (shingles) is an infection of peripheral nerves arising from a re-activation of which primary childhood viral infection?

Answers

Answer:

CHICKENPOX

Explanation:

Varicella-zoster virus (VZV) causes chickenpox and herpes zoster (shingles).

CHICKENPOX follows initial exposure to the virus.

After the chickenpox runs its course, the virus retreats to nerve tissues near the spinal cord and brain, where it hides out.

Reactivation of the dormant virus results in the characteristic painful dermatomal rash of HERPES ZOSTER, which is often followed by pain in the distribution of the rash (postherpetic neuralgia).

Reactivation can be due to:-

1) A weakened immune system, which can wake the virus up

2) Cancer, HIV, or another disease that lower your body’s immunity

3) Being 50 or older

4) Being under a lot of stress

5) Past physical trauma

6) Taking long-term steroids or other medications that can weaken your immune system.

A nuclear reactor overheated, releasing radiation throughout the plant. A worker close to reactor received at least 800 rads and has had an onset of vomiting, bloody diarrhea, and, when brought to the hospital, was in shock. What is this patient's predicted survival?

a) Likely
b) Possible
c) Probable
d) Improbable

Answers

Answer:

Option d) Improbable

Explanation:

People in Improbable group have acute onset of shock, vomiting and diarrhea. According to Centers for Disease Control and Prevention (CDC) symptoms like that suggest patients are exposed to radiations which is lethal for them. These patients will not fall under the category of survivors.

A tissue has many layers and the cells have all kinds of shapes. They are columnar at the bottom, cuboidal in the middle, and squamous at the top. What would we call this tissue?

Answers

Answer: Transitional epithelium

Explanation:

Transitional epithelium is a kind of stratified epithelium which  consists of multiple layers of epithelial cells which can expand and contract.

It lines the organs of the urinary system and is also known as urothelium.

The expansion and contraction of this tissue is to provide distension to the tissues. The shape of the transitional epithelium varies as it is columnar at bottom, squamous at top and cuboidal in the middle.

When DNA replicates, the resulting DNA molecules are made up of one original strand and one new strand. This is important for the conservation of genetic information. This type of replication is called_____________.

Answers

Answer:

This type of replication is called  semi-conservative

Explanation:

According to the semi-conservative replication during the replication process each strand is a mold that by the principle of the complementarity of bases forms a new copy of the strand. In other words, each resulting strand is composed of an old and a new strand.

The globulins that make up part of the plasma of the blood have three distinct purposes. What are the gamma globulins?

Answers

The gamma globulins are Antibodies of the immune system.

Explanation:

These belong top the globulin class. These are used for the process of improving the immunity level of any person. These are developed form the cells of lymph glands and bone marrows. Hence when they are introduced into a person it will cause hepatitis C. They are the antibodies of Immune system.

Since they introduce hepatitis C in the person who receives this, when they are given along with blood, these are treated before introducing to the persons. they are generally used for improving the immunity level of any person and those persons who are infected by hepatitis A or measels.  

What codes for proteins?

Answers

Answer:

gene

Explanation:

the genes that code for protein are made up of tri-nucleotide units called condons

Amino acids, they’re decided on the base pair triplets in DNA :)

Adults with more than a twelve (12)-month history of migraines were assigned randomly in a double-blinded study to receive treatment with experimental drug X (10 or 20 mg/day) or placebo. The primary efficacy measure was the reduction in severity of the migraine attacks. Enrollment was twelve-hundred (1200) subjects. Which of the following best describes the clinical phase of this study

Answers

Answer:

Phase III.

Explanation:

Clinical research includes the different steps to test the particular drugs and its use for the medical treatment. Clinical research is divided into four main phases.

The phase III of the clinical research includes the double blinded study and its clinical trial on the patients. This phase determines the drug safety and efficacy. The therapeutic effect of the drug is tested directly in phase III of the clinical trial.

Thus, the answer is phase III.

The study with 1,200 subjects testing the efficacy of a drug for migraines is best described as Phase III. The correct option is B.

Phase III clinical trials typically involve between 1,000 and 3,000 patients and are conducted in double-blind studies across several hospital sites. These trials primarily aim to establish the drug's long-term safety, effectiveness, recommended dosage, and benefits, making them applicable for the given study design with 1,200 subjects analyzing the efficacy of the drug on patients with a history of migraines.

Following are the briefly explanation:

Preclinical Phase I: Focuses on testing the drug on animals to assess safety and efficacy, not applicable here.Phase II: Involves a smaller number of patients (usually 100-300) focusing on effectiveness and short-term side effects, thereby not fitting the study with 1,200 subjects.Phase III: Intended for large-scale studies involving several hundred to thousands of patients, to test long-term efficacy and safety, which aligns with the study described in the question.

Thus, the study design with 1,200 subjects fits the criteria for Phase III clinical trials.

Complete question:

Adults with more than a twelve (12)-month history of migraines were assigned randomly in a double-blinded study to receive treatment with experimental drug X (10 or 20 mg/day) or placebo. The primary efficacy measure was the reduction in severity of the migraine attacks. Enrollment was twelve-hundred (1200) subjects. Which of the following best describes the clinical phase of this study?

A. Phase II

B. Phase III

C. Preclinical Phase I

Other Questions
How did the Atlantic slave trade contribute to conditions that eventually led tothe Haitian Revolution?OA. It created a huge slave population that hoped to overthrow Saint-Domingue's social system.OB. It led European countries to pull their military support from Saint-Domingue in protest.C. It outraged mixed-race laborers in Saint-Domingue who lost theirjobs when farms bought slaves.D. It led to an economic depression due to the high cost of slaves. In order to find the height of a cliff, you stand at the bottom of the cliff, walk 60 feetfrom the base, and place a mirror on the ground. Then you face the cliff and step back5 feet so that can see the top of the cliff in the mirror. Assuming your eyes are 6 feetabove the ground, explain how to use this information to find the height of the cliff.(The angles marked congruent are congruent because of the nature of the reflection oflight in a mirror.)Q5ft60 ftKMirror Mattie is making a collar for her dog. She needs to buy some chain,a clasp, and a name tag. She wants the chain to be 40 centimeters long. One meter of chain costs $9.75. The clasp is $1.29 and the name tag is$3.43. How much will it cost to make a collar? 2. What was required for GA to rejoin the Union? What is a real world situation for the problem 42.48 Divided by 25 Please help ASAP will give BRAINLIEST ANSWER!!!!!!! After the defendant's attorney has finished calling witnesses, the plaintiff's attorney can call witnesses and put forth evidence to rebut the defendant's case. This is called a _____.A. resolution B. restitution C. remittitur D. rebuttal E. rejoinder How did King Taejo eliminate his competitors?He sent them into exile.He had them killed.He turned them into slaves.He made them become priests Find the solution of the given initial value problem. ty' + 6y = t2 t + 1, y(1) = 1 6 , t > 0 why might king have gone into such specific detail about steps taken and recent events in birminghham this early in the letter Darcys house is 6 times as far from school as her friends house. If her friends house is 3/4 mile from school, how many miles from school is Darcys house? the average number 1 0 1 5 6 3 4 The particles that are found in the nucleus of an atom area. neutrons and electronsc. protons and neutronsb. electrons onlyd. protons and electrons The Oldowan tool tradition is primarily associated with what group of early human ancestors An unknown protein are dissolved in enough solvent to make of solution. The osmotic pressure of this solution is measured to be at .Calculate molar mass of a protein. 4. In "A Tree Telling of Orpheus," why is it effective to use a tree as the speaker?a. It makes the story of Orpheus more believable.b. It gives the poem a lighthearted feeling because of its impossibility.c. It allows readers to imagine Orpheus's power more vividly.d. It explains the unusual arrangement of the poem's line breaks. Dr. Hoda measures job satisfaction and number of years of education. In examining her scatterplot, she sees the cloud of points has no slope. This indicates which type of relationship? Because assembly language is so close in nature to machine language, it is referred to as a ____________. Which of the following hormones is released by the anterior pituitary as a part of that positive feedback loop between it and the ovary? Find the (a) mean, (b) median, (c) mode, and (d) midrange for the data and then (e) answer the given question. Listed below are the weights in pounds of 1111 players randomly selected from the roster of a championship sports team. Are the results likely to be representative of all players in that sport's league? 278303186292276205208236278198208a.Find the mean.The mean is ? pound(s).(Type an integer or a decimal rounded to one decimal place asneeded.)b. Find the median.The median is ? pound(s).(Type an integer or a decimal rounded to one decimal place asneeded.)c. Find the mode. Steam Workshop Downloader