Deep processing of verbal information involves encoding the ________ of words.

a. sizes

b. shapes

c. meanings

d. sounds

Answers

Answer 1
c. meanings i believe

Related Questions

Jit (just in time) methods are designed primarily to

Answers

where are the answer choices

Here is a fun exercise to drive this point home. pull out your calculator, and try your hand at this: when you were conceived, what were the odds that of the many possibilities, your parents would come up with you?

Answers

Humans can produce over 8 million unique gametes due to independent assortment of chromosomes. When these gametes randomly fertilize each other, the potential genetic variations exceed 64 trillion combinations.

The number of different gametes that can be formed because of independent assortment is 2n, where n is the number of homologous pairs. In humans, with 23 homologous pairs of chromosomes, the number of possible gametes due to independent assortment is 223 or over 8 million unique combinations. To understand the sheer variety of potential offspring, we consider the effect of random fertilization. You would multiply the number of unique gametes from one parent by the number of unique gametes from the other parent, resulting in over 64 trillion unique combinations, not including the additional variation introduced by crossing-over.

complete question given below:

Here is a fun exercise to drive this point home: Pull out your calculator and try your hand at this: When you were conceived, what were the odds that, out of the many possibilities, your parents would come up with you?

a. The number of different gametes that can be formed because of independent assortment is 2n, where n is the number of homologous pairs. Therefore, since humans have 46 chromosomes or 23 homologous pairs, what is the number of possible gametes that can be formed due to independent assortment of chromosomes? #bcut$,Y million

b.Now, this is the number of unique gametes your mom could have made. Your father could have made the same number. To see the effect of random fertilization, multiply the number of gametes one parent could make by the number of unique gametes the other parent could make.

Your answer should be in the trillions, and all of this is without crossing over. See how special you are?

Conscious recall of lasting memories most directly depends on the childhood maturation of the

Answers

The answer is Hippocampus
Hippocampus is the part of the brain that functioned to stored Long-term memory and bring it to the surface when we need it.
The type of memory that could be brought to the surface explicitly tend to be limited only to relevant information even though our brain is capable of remembering infinite memories.

Lai worked on a global team for an american company, and all her work had to be completed in her second language, english. sometimes her teammates misinterpreted her meaning. lai has unintentionally created of a(n) ______ barrier to communication.

Answers

The answer is "Encoding Barrier" to communication.

This kind of barrier mean when what you say to someone is not expressed as you originally had desired it to be. For example if someone is working in an environment where his/her first language is not being used as the primary way of communication, he/she may have issues explaining what they mean to their co-workers, subordinates or bosses. 

List and explain the "constitutional limitations" when drafting a "criminal statute".

Answers

1. Ex Post Factois the limitations with regards to future which means they cannot be taking effect on the time that is in the past. 2. Bills of Attainder is another drawback that law cannot inflict sentence or punishment without the involvement of judicial setup. 3. The petition of Habeas Corpus Writs determining the existence of lawful detention by government. 4. Freedom of speech which limits the government in the regulating the manner of speech and other aspects of speech. 5. Government unable to deny due process rights. 6. Equal Protection Clause, this limitation can bring chaos if the classification is unreasonable.

Constitutional limitations when drafting a criminal statute are essential to ensure that the law is consistent with the principles and rights enshrined in the Constitution. Here are some of the key constitutional limitations:

1. Void for Vagueness: A criminal statute must be clear and precise to provide fair notice to individuals about what conduct is prohibited. If a statute is too vague, it can be struck down under the Due Process Clause of the Fourteenth Amendment.

 2. Overbreadth: A statute is unconstitutionally overbroad if it prohibits a substantial amount of protected free speech or expression along with the conduct it seeks to criminalize. The First Amendment protects against such overbroad statutes.

 3. Specificity: The statute must define the criminal offense with sufficient definiteness that ordinary people can understand what conduct is prohibited and in a manner that does not encourage arbitrary and discriminatory enforcement.

 4. Equal Protection: The Equal Protection Clause of the Fourteenth Amendment requires that a criminal statute apply equally to all individuals. It cannot discriminate on the basis of race, national origin, gender, or other suspect classifications unless there is a compelling government interest and the law is narrowly tailored to achieve that interest.

 5. Ex Post Facto Laws: The Constitution prohibits ex post facto laws, which are laws that retroactively criminalize acts that were legal when committed, increase the punishment for an act after it was committed, or change the rules of evidence to make conviction easier.

 6. Bill of Attainder: A criminal statute cannot be a bill of attainder, which is a legislative act that inflicts punishment without a judicial trial.

 7. Double Jeopardy: The Fifth Amendment's Double Jeopardy Clause protects against multiple prosecutions for the same offense. A statute must not allow for successive punishments for the same conduct.

 8. Right to Counsel: The Sixth Amendment guarantees the right to counsel in criminal prosecutions. Statutes must not infringe upon this right by denying access to legal representation.

 9. Right to a Jury Trial: The Sixth Amendment also guarantees the right to a jury trial in serious criminal cases. Any statute that denies this right or limits it in an unconstitutional manner would be invalid.

 10. Cruel and Unusual Punishment: The Eighth Amendment prohibits cruel and unusual punishments. Criminal statutes must not prescribe penalties that are disproportionate to the crime or that constitute torture or other inhumane treatment.

 11. Right to Confrontation: The Sixth Amendment's Confrontation Clause provides that the accused shall enjoy the right to be confronted with the witnesses against him. Statutes must not infringe upon the ability of the defendant to cross-examine witnesses.

 12. Right Against Self-Incrimination: The Fifth Amendment protects individuals from being compelled to incriminate themselves. Criminal statutes must not force individuals to provide testimony that could be used against them in a criminal case.

 13. Procedural Due Process: The Due Process Clause requires that criminal statutes provide for fair procedures in the prosecution of crimes. This includes grand jury indictment, notice of charges, and a fair and impartial hearing.

 14. Substantive Due Process: Substantive due process limits the power of the state to infringe on certain fundamental rights and liberty interests, even if procedural due process is provided.

 When drafting criminal statutes, legislators must carefully consider these constitutional limitations to ensure that the statutes are valid and enforceable. Courts will strike down any statute that violates these constitutional principles.

In his exposition and protest, john calhoun argued that a state has the power to:

Answers

He argued that a state has the power to leave the union. The document was a protest against the Tariff of 1828, also known as the Tariff of Abominations. The document stated that if the tariff was not repealed, South Carolina would secede.

According to erikson, children have _____, and thus believe that they can achieve any goal.

Answers

According to Erickson, children have "an unrealistic self-concept", and thus believe that they can achieve any goal.
Erik Erikson who was born in 1950 proposed a psychoanalytic hypothesis of psychosocial advancement including eight phases from early stages to adulthood. Amid each stage, the individual encounters a psychosocial crisis which could have a constructive or contrary result for personality development.

Final answer:

Children at the Industry vs. Inferiority stage, according to Erikson, possess an unwavering optimism that enables them to believe they can achieve any goal. This confidence is built upon their experiences of success, which enhance their self-efficacy and self-esteem.

Explanation:

According to Erikson, children have unwavering optimism and confidence, and thus believe that they can achieve any goal. This belief stems from the Industry vs. Inferiority stage, where children are categorically busy or industrious. Erikson posited that if children in middle and late childhood are successful in their endeavors, they develop a strong sense of confidence for facing future challenges. However, if they do not find success, they may develop a sense of inferiority. These experiences are crucial in shaping children's self-worth, self-confidence, and sense of pride about their achievements.

It is during this phase that children's self-efficacy, which involves believing in their ability to carry out a specific task or reach a specific goal, develops significantly. Frequent performance opportunities can raise their aspirations and create safe opportunities for risk-taking. This allows them to experience success on multiple occasions, thereby enhancing their self-efficacy and overall self-esteem.

What is not true about social groups?

Answers

a. Culture is learned.
b. Culture is similar across cultures.
c. Culture is transmitted from one generation to the next.
d. Culture is shared.
e. Culture is adaptive and always changing.

Hopefully this helps!!!

An older fraternity member convinces jenn and her friends to try a new drug at a party. within a half hour they are feeling great, hugging each other, sweating, and feeling thirsty; soon they also begin to feel overheated. the drug they took is most likely:

Answers

The drug they took is most likely to be MDMA which is also known as ecstasy. This is a psychoactive drug first and foremost used as a recreational drug. The anticipated recreational effects consist of increased fellow feeling, excitement, and intensified sensations. When taken by mouth, the effects commence after 30 to 45 minutes and will endure 3 or up to 6 hours.

T is the late 1800's. you are deeply in debt. why do you prefer bimetallism (unlimited coinage of silver)?

Answers

The resulting inflation will allow me to pay back my debt with money that is worth less than what I borrowed and is easier to come by.

The cook and carry, targeted to epicureans, is cordless and easily portable. this is an example of ________.

Answers

This is an example of benefit segmentation. It is dividing the market based upon the observed value benefit, or advantage consumers distinguish that they receive from a product or service. You can divide the market founded upon quality, customer service, performance, special embellishments, or other benefits.

Cell references that reference other sheets behind the summary sheet are known as ____ references

Answers

The answer to this question is 3-D references.
3-D references usually contain same cell range on several different sheets. A 3-D reference is often used so sveral worksheets could follow a certain pattern when you put same data. This will make you  able to input it faster rather than have to do it over and over again.

"The correct term for cell references that reference other sheets behind the summary sheet is ""3D references.""

In Excel and other spreadsheet applications, when you create a formula that refers to cells on other sheets, you are essentially creating a reference that extends beyond the two-dimensional plane of a single sheet. This type of reference is called a 3D reference because it includes the third dimension, which is the sheet number or name.

A 3D reference directly specifies a cell or range of cells on a different sheet from the one currently being viewed. For example, if you have a summary sheet and you want to reference cell A1 from Sheet1, you would write the reference as 'Sheet1'!A1. If you want to reference a range of cells from multiple sheets, you can use a 3D reference like 'Sheet1:Sheet3'!A1 to refer to cell A1 on each sheet from Sheet1 to Sheet3.

Using 3D references can be very useful for creating summary reports or for consolidating data from multiple sheets into a single sheet. However, it's important to note that 3D references can make your formulas more complex and harder to audit or troubleshoot. They also may not be supported in all spreadsheet functions or scenarios."

* HELP* This is economics!!

1.)Which of the following is a disadvantage of mass production?

A. Lost jobs
B. Job gains
C. Increased profits
D. Productivity gains

2.) Each worker doing a small part of the overall manufacturing process is known as

A. automation.
B. specialization.
C. appreciation.
D. interchangeable parts.

3.) Which of the following is a disadvantage of the sole proprietorship form of ownership?

A. Unlimited liability
B. Control over the business
C. Split responsibility
D. Limited liability

4.) The period of time when business slows, workers are laid off, and GDP declines is what part of the business cycle?

A. Expansion
B. Recession
C. Trough
D. Peak

5.) The government has an interest in promoting competition between businesses because competition results in

A. lower prices and lower-quality products
B. higher prices and lower-quality products
C. higher prices and higher-quality products
D. lower prices and higher quality of products

6.) Which of the following is an advantage of the sole proprietorship form of ownership?

A. Limited liability
B. Split responsibility
C. Control over the business
D. Unlimited liability

7.) Which of the following groups decides who sits on the board of directors of a corporation?

A. The US government
B. Consumers
C. American voters
D. Shareholders

8.) Limited liability is an advantage of what form of business ownership?

A. Partnership
B. Franchise
C. Sole proprietorship
D. Corporation

9.). The plan for how the government will raise and spend money is known as the

A. federal budget.
B. federal treasury.
C. spending plan.
D. Federal Reserve.

10.) Which of the following is a reason for the growth of federal government spending?

A. Deflation
B. Growing population
C. Shrinking population
D. Less demand for services

Answers

Disadvantages of Mass Production. Mass production may result in wasted resources.  
9.). The plan for how the government will raise and spend money is known as the *federal budget*

5.) The government has an interest in promoting competition between businesses because competition results in  *lower prices and higher quality of products*

Why do people take political cues from others rather than studying the issues themselves?

Answers

People take political cues from others rather than studying the issues themselves because they want shortcuts and also when they talk to other people about political issues they also get their opinion what they are thinking about that specific political issue. And also these days life is very busy and most people do not have too much time to read and study about the issues themselves.

Answer:

I just want points

Explanation:

Before the civil war virgina was united however in 1863 West Virginia chose to become independent which is the most reasonable cause of West Virginia’s secession from the rest of the state

Answers

West Virginia became a state in 1863 composed of 50 counties of Virginia from the northwest, southwest and Shenandoah areas of western Virginia. 24 of those counties had voted for secession from the United States along with the rest of Virginia. (Richard Curry, "A House Divided", pg 49) Unionists in western Virginia set up a Union state government in Wheeling, and passed an ordinance to create a new state. On Oct. 24, 1861, the ordinance was approved by 18,408 votes. The voting population of the 50 counties from the 1860 census was 79,515. Most of the state was composed of secessionist counties that were included against their will. West Virginia gave approximately 20,000 soldiers to the Confederacy and 20,000 to the Union. (Mark Snell, "West Virginia and the Civil War", pg. 28) The war enabled Unionists to create the state, which would not have been possible in peace time. In 1872 when voting rights were returned to all West Virginians the 1863 Unionist constitution was discarded by popular vote and a new state constitution written and approved that was based on the old Virginia constitution.

how has internet access changed and affected globalization from 2003 to 2013

Answers

From 2003 to 2013 more publicly available hot spots have opened all over the world, and smart phones, something that wasn't even conceived until mid 2006, are very common now, allowing a lot more users to connect with each other worldwide :)

Answer:

Between 2003 and 2013 internet has changed the business world into a global market.

Explanation:

Globalization refers to trade and cultural exchange between countries. Internet has been by far the largest contributor to globalization. Internet has helped global telecommunications breaking barriers of time and space, creating a global community and a global economy.  

Internet has radically changed the business world by helping entire countries and industries to improve their competitiveness and increase productivity. It has speeded the access to information, electronic transactions and has opened up new job markets.

Christina is in the eighth grade and is taking pre-algebra. she is doing very well and will be taking algebra 1 next year. christina is most likely in which of piaget's stages of cognitive development?

Answers

Christina is most likely in Formal Operational Stage of Piaget's stages of cognitive development. Because in this stage, adolescences already have logical skills on using symbols applied to abstract concepts like science and algebra. They have now the ability to think of multiple variables in organized ways, consider possibilities, and formulate hypotheses. They also have the ability to examine concepts like justice and abstract relationships.

Final answer:

Christina is likely in Piaget's formal operational stage of cognitive development, where adolescents develop abstract thinking and logical reasoning about hypothetical situations.

Explanation:

Christina, who is in the eighth grade and will be taking Algebra 1 next year, is most likely in Piaget's formal operational stage of cognitive development. This stage typically starts at age 12 and continues for the rest of an individual's life. During the formal operational stage, adolescents develop the ability to think abstractly and engage in logical reasoning about hypothetical situations, which includes understanding abstract concepts such as numerical magnitudes and hypothetical-deductive reasoning.

Given her progression to more complex mathematical courses, Christina's cognitive skills are likely becoming more refined, evidencing the development of advanced reasoning abilities characteristic of the formal operational stage.

Describe four areas of self-esteem discussed in the text and provide an example of each. what are three characteristics that contribute to high or positive self-esteem? what are three characteristics that contribute to low or negative self-esteem? describe how a person can have both high and low self-esteem. why is it important for a parent to create a strong bond with a child during the first two years of life? how does a person's sense of self change from infancy to age 7 or 8 and from ages 10 to 11 into the teenage years? critical thinking questions how would you explain self-esteem to someone? discuss how a parent can help their child develop good social self-esteem. discuss how a parent can help their child develop academic self-esteem. describe someone you know who has high self-esteem. describe someone you know who has low self-esteem.

Answers

1. The four areas of self-esteem are:
- social self esteem - is just being accepted by your family, peers or anyone around you. An example of this is your popularity standing in school. Or having many friends could be another example.
- academic self esteem - being able to do well in school. An example would be how people perceive you as intelligent person.
- physical self esteem - one's belief on how they look and how others perceive someone's look. An example would be if a person complimented on how someone's look.
- moral self esteem - an individual's belief that you are a good person since you are doing what is good. An example would be if you are doing the right thing always.

2. The characteristics that contribute to high or positive self-esteem are good communication skills, ambitious, and optimistic.

3. The characteristics that contribute to low or negative self-esteem would be the opposite of the answers in number 2 which are poor communication skills, pessimistic, and fail to achieve goals.

4. It is important for a parent because if a child see who they are living with and who they’re dealing with. It will be much at ease on them to acquire and show respect for the next years.

5. Infants are not normally aware of any self-change. At this time in their lives they are still fresh to the world and consequently, they are just attentive on taking everything in. Though they might not know it, they are evolving both psychologically and physically. Children who are aged 7-8 are likewise not interested in self-change. On the other hand, when reaching the age or 10-11, children are mindful of their familiarity, competences and self-change. They have more knowledge in the world compared to infants and are getting prepared for their pre-teen and teenage years. In the teenage years arisen puberty. This is an observable change every person experiences and whether they want to notice or not, they get to understand how they are shifting every day. As for familiarity, teens progress from grade 8 and change from elementary school to high school. Going into high school changes many things for an individual such as their group of friends, favorites, and life goals.

6. Self-esteem is the opinion about themselves. 

7. Parents must improve a strong bond with their children, and by pouring admiration on their children entirely.

8. By boosting their children how vital school is for their future.

9. My friend has high academic self-esteem; she is very positive, and very determined. She always attempts her toughest in all her classes and loves to get admiration about her good grades.

10. My friend has very low self-esteem. He has a very negative viewpoint, and can’t attain his goals. He has a lot of worries and inclines to form unhealthy relationships with others.

When attitude becomes action: select one:
a. prejudice becomes discrimination
b. stereotyping becomes prejudice
c. bias becomes bigotry
d. bias becomes prejudice?

Answers

d.bias becomes prejudice

Final answer:

The phrase 'When attitude becomes action' refers to the transition from prejudice, which is a biased attitude, to discrimination, which encompasses biased actions against a group or individual. The correct answer is 'a. prejudice becomes discrimination'. Discrimination can manifest in various forms, such as biased hiring practices, and is demonstrated through historical instances of overt discrimination like Jim Crow laws.

Explanation:

When we consider how attitude becomes action, it is essential to understand the transition from internal biases to outward behavior. In this context, the answer to the question 'When attitude becomes action:' is a. prejudice becomes discrimination. Prejudice refers to preconceived opinions or feelings, often negative, towards a person or group based on their characteristics, such as race or ethnicity. Although prejudice itself is an attitude, when one acts on those prejudiced beliefs, it manifests as discrimination. Discrimination is the unjust treatment of different categories of people, particularly on the grounds of race, age, or sex.

An example of discrimination might include a company engaging in biased hiring practices, which could range from requesting applications only from certain demographic groups to unfairly promoting employees of one race over another. Historical examples like the 'No Irish Need Apply' signs and Jim Crow laws provide clear illustrations of discrimination based upon prejudiced attitudes. The passage from biased thoughts to discriminatory actions has far-reaching impacts on individuals and society.

Stereotyping, which is related but not identical to prejudice, involves oversimplified generalizations about a group. These stereotypes can feed into prejudice, which in turn can lead to discriminatory actions. Holding stereotypes may not always result in discriminatory behavior, but it lays the groundwork for prejudice to flourish. Therefore, while we acknowledge that bias becomes prejudice (option d), it is when this prejudice leads to actions that we specifically talk about discrimination.

why is it so important for weaker countries to keep Germany in the NATO and European Union?

Answers

Germany, the largest economy in the European Union, has come in for particular criticism for its relatively cautious defence budget, and as Angela Merkel pays her first visit to President Trump on Friday, many will be looking to see whether the Chancellor will convince her main ally that leading European nations are serious about paying their fair share. For some time, American government officials, defence secretaries and even presidents have accused Europe of “free riding” on the United States for their security.

According to sociologists with macro-level orientations, what is the purpose of social rules?

Answers

Answer: All of the above

Explanation:

Final answer:

Social rules serve to maintain stability and social order, enforce shared values, and can reflect societal power dynamics and inequalities according to macro-level orientations such as functionalism and conflict theory. Symbolic interactionism, however, focuses on interpersonal interactions that shape and reinforce norms.

Explanation:

According to sociologists with macro-level orientations, the purpose of social rules is multifaceted. For functionalists like Durkheim, social rules and norms function to maintain stability in society and ensure the continued existence of social order by setting guidelines that individuals in a society must follow. These norms range from formal laws to everyday customs and serve multiple functions such as protecting society from violence, maintaining public health, and reinforcing social values and shared languages.

On the other hand, conflict theorists may analyse social rules to understand power dynamics, questioning who creates and benefits from these rules, and who may be oppressed or suffer under them. This perspective focuses on how social norms and institutions can reflect and perpetuate social inequalities and the relations of production within a capitalist system.

Symbolic interactionists, however, are more interested in examining the day-to-day interactions and meanings that individuals attribute to social norms, and how these interactions contribute to the shaping and reinforcement of those norms. From this view, it is the shared meanings and interactions around norms that are pivotal to understanding social life.

In economics, the cost of something is
a. often impossible to quantify, even in principle.
b. always measured in units of time given up to get it.
c. the dollar amount of obtaining it.
d. what you give up to get it.

Answers

the answer id C I hope this help you

Approximately what percentage of the population of the colonies were Patriots?

Answers

The answer is 45% were patriots

it is 45% but will be rounded about 50%

Which activity is an example of an ethos appeal in a wartime speech?

Answers

Showing images of the destruction by an enemy attack

The answer is: Showing images of the destruction by an enemy attack

An appeal of ethos refers to a form of persuasion technique that  conducted by making the people related to a certain ethical value.Showing image of destruction form an enemy attack would create people's sense of ethic and see the war against the enemy as a good/noble cause.

The rise and fall in sea level as a tide crest approaches and passes will cause a(n):

Answers

the rise or fall in sea level as a tide crest approaches and passes will cause a tidal current of water to flow into or out of bays and harbors. Become more complex in the open sea. water rushing into an enclosed area because of the rise in sea level as the tide trough approaches is called flood current

what do sound waves, light waves, moving objects, and heat flow all have in common?

a. they all require a medium to travel.
b. they all transfer energy
c. the are all electromagnetic waves,
d. they are all mechanical waves

please help soon :)

Answers

Your answer is B they all transfer energy because light energy transfers energy by hitting a solar panel and turning it to electrical energy moving objects transfer energy by when its not moving potential energy and when it is moving its kinetic energy and heat flow transfers energy by conduction on a spoon also its not A because light travels more faster than anything in the world its not C because C requires electrical current an although heat and light can be turned into electrical energy moving objects can't when its came down to rather B, and D I choose B because D has mechanical energy and mechanical energy is made by like paper burning into ashes or a apple rotting and none of them change substances so your answer is B.

Your answer is B.

The energy is transmitted in different forms such as through conduction, convection, and radiation. The reason behind it is mechanical movement and changing objects' motion or position.  

All the given objects transfer energy in the following ways:

Sound waves transfer energy through the vibration created by the air particles. Light energy transfers energy through passing by empty spaces.Moving objects transfer energy by using kinetic energy. Heat flow transfers energy when passed through a warmer object to a cooler object.

Learn more about energy here:

https://brainly.com/question/5869707

When one party is better informed about an economic situation than another party, economists describe the problem as one of?

Answers

In the given situation, the answer is moral hazard. A moral hazard happen when a party is involved in a situation in which the other party is likely be a result of what will happen in the outcome as there is a presence of incomplete information with both of the parties involved.

Janis has volunteered to participate in a psychology experiment. when she arrives, a lab assistant standing on the other side of a counter greets her. he explains the informed consent procedure and asks her to sign a form. as the lab assistant reaches for the form he drops it behind the counter. he drops down behind the counter to pick it up, but another person stands up holding the form. after janis signs it, she is asked if she noticed the change. she replies that she did not. this phenomenon is known as:

Answers

The phenomenon is known specifically as the change blindness. This is a phenomenon where in the observer has fail to notice the differences that has been laid out to him or her when a certain visual stimulus is triggered or the observer is exposed to.

what issues divided the nations of Europe during the 1500s

Answers

Religious issues ,because they challenged the catholic Church and the Pope.
Religious issues because they challenged the church and the pope

SOMEONE ASAP PLZ AND THANKS!!!

Answers

Hello!

Here are the answers:

12. Answer: The Communists controlled the government and economy instead of the people.

13. Answer: Russia has developed their economy by becoming the second largest exporter of oil and natural gas.

14. Answer: They repressed a majority of people in favor of a minority.

I really hope this helped you out! :)
Other Questions
The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Why is it important that melanin is present in its highest concentration in the keratinocytes at or near the basale layer of cells? What conclusion can you draw from the fact that Spanish and Portuguese are the most commonly spoken languages in Latin America? A)Latin Americans have chosen to speak Romance languages. B)Latin Americans were born in Spain and Portugal and then moved. C)Spain and Portugal colonized Latin American nations during the 15th and 16th centuries. D)Many Latin Americans travel to Spain and Portugal and learn the language while visiting. which function represents a vertical stretch of an exponential function The formula I = PRT where I = Interest, P = principal, R = rate, and T = time is used to calculate the amount of simple interest earned. Solve this formula for T. T = I + PR T = I PR T = I divided by the quantity P times R T = IPR Steam Workshop Downloader