Following the battle of Fort Sumter, consequences on the Southern side included:

Lincoln called for 75,000 volunteers to enlist.

Lincoln used judicial proceedures to uphold the Union.

Lee joined the Southern army as ALL slave holding states seceded.

Lee joined the Southern army as all but 4 slave holding states seceded.

Answers

Answer 1
Here is the answer that would best complete the given statement above. Following the battle of Fort Sumter, consequences on the Southern side included Lee joined the Southern army as ALL slave holding states seceded. Hope this is the answer that you are looking for. 
Answer 2

Answer:

Lee joined the Southern army as ALL slave holding states seceded.

Explanation:


Related Questions

How did the Reformation bring about two different religious paths in Europe

Answers

Catholic monarchs and the Catholic church fought against the Protestant challenge, they took steps to reform the Church and to restore its spiritual leadership of the Christian world, Protestant ideas still spread.


1.) Describe the rise of Jim Crow, Plessy v. Ferguson, and the emergence of the NAACP.

2.) . Describe the significance of progressive reforms such:
a. The initiative-
b. Recall-
c. Referendum-
d. Direct election of senators-
e. Reform of labor laws-
f. Efforts to improve living conditions for the poor in cities-

3.Describe the conservation movement and the development of national parks and forests; include the role of Theodore Roosevelt.

4. Explain the Chinese Exclusion Act of 1882 and anti-Asian immigration sentiment on the west coast.

Answers

#1) Describe the rise of Jim Crow, Plessy v. Ferguson, and the emergence of the NAACP.

Answer: The rise of Jim Crow and Plessy v. Ferguson was about the the race relations in the South which had worsened. African American were basically denied basic rights. They were discriminated and segregated much worse than after the Civil War. The segregation laws that were passed in the Southern and border states were called the Jim Crow laws. It got to the point where african americans used separate public and private facilities. It led to inferior education, health care, and transportation. The way to oppose Jim Crow laws was to form the group NAACP which had the purpose of equality for African Americans.

#2) Describe the significance of progressive reforms such:

Answer: The significance of progressive reforms was very important. They supported new ideas and policies with the improvement of people's lives in mind. They supported increased government regulation of business and industry, the protection of consumers and workers, and the policies that would enable the conservation of natural resources. The main efforts were to improve the living conditions for the poor in cities. As a result there were better libraries, schools, hospitals, and parks.

#3) Describe the conservation movement and the development of national parks and forests; include the role of Theodore Roosevelt.

Answer: President Theodore Roosevelt initiated this progressive conservation movement with the goal to conserve millions of acres of wilderness lands. His efforts were successful and they led to the establishment of a national park system that included Yosemite in California and Yellowstone in Wyoming.

#4) Explain the Chinese Exclusion Act of 1882 and anti-Asian immigration sentiment on the west coast.

Answer: Basically the people from america were angered at the fact that their pay would be lowered because of the Chinese immigrants. Because the Chinese immigrants accepted low wages for jobs that american people held. For this reason they encouraged Congress to pass the Chinese Exclusion Act, which was established in the year 1882, banning all future Chinese immigration.

I hope it helps, Regards.

Which area of Europe was fought over because it's iron and coal deposits were important to industrialization

Answers

I think It was Belgium

How much did the government regulate business practices during the Gilded Age

Answers

Well, as far as  remember, during the Gilded Age the government hardly regulated business practices, as history says - almost none regulation. And due to such conditions, United States appricated child labor, law salaries and awful plans of safety. I am pretty sure it will help you!
Regards.

Answer:

a

Explanation:

How did European colonial possessions and practices in Asia and Africa differ from practices in the Americas?

Answers

To answer the above question, the European possession differed from practices in Asia and Africa because of trade differences and even ages of territories.

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

The runs on banks during the Great Depression worsened the country's economic situation because the bank runs
A) caused banking institutions to collect funds from the government.
B) caused overseas investors to worry about giving money to America.
C) caused the government to stop reimbursing currency for gold bullion.
D) caused many banks to close and created an even greater shortage of money.

Answers

The correct answer of the given question above is option D. The runs on banks during the Great Depression worsened the country's economic situation because the bank runs caused many banks to close and created an even greater shortage of money. Hope this answers your question.

Answer: D

Explanation:

We assume that the early governments in the ancient Middle East was less centralized because of

divergent and distant trade patterns

the weakness of their armies and the frequency with which they were defeated by foreign foes

the existence of city-states

the absence of writing
2.
An important similarity between the pre-Columbian civilizations in meso-America and classical Greece was

warring city-states

trade with nearby civilizations

gods who possessed human characteristics

a common calendar
3.
Soldiers from India would have most likely fought in WWI against

the French

the British

Russians

Germans

Answers

Answer;did thei ds  smff fivf ,

Explanation:kksnfjf fjsj  fj

The ancient Middle East had less centralized governments due to city-states, commonalities between Mesoamerican civilizations and classical Greece included warring city-states, and Indian soldiers in WWI most likely fought against the British.

1. The early governments in the ancient Middle East were less centralized primarily due to the existence of city-states. These city-states had their own independent governments and authorities, leading to a decentralized political system.

2. An important similarity between the pre-Columbian civilizations in Mesoamerica and classical Greece was the presence of warring city-states. Both civilizations were characterized by independent city-states engaged in frequent conflicts and warfare.

3. Soldiers from India in WWI would have most likely fought against the British. India was a British colony during WWI, and Indian soldiers actively participated in the war on the side of the British.

Who gets to decide how many federal courts we have

Answers

1Congress sets up the rest of the federal court system. "The judicial Power of the United States, shall be vested in one supreme Court, and in such inferior Courts as the Congress may from time to time ordain and establish."
Final answer:

Congress has the authority to decide on the number of federal courts in the United States.

Explanation:

The number of federal courts in the United States is determined and established by the Congress, one of the three branches of the federal government. Specifically, it is within the constitutional authority of the Congress to create and organize federal courts, as outlined in Article III of the U.S. Constitution.

For example, the Judiciary Act of 1789, passed by Congress, established the structure of the federal court system, including the creation of the Supreme Court and various lower federal courts.

The number of federal courts can be modified or expanded by Congress through legislation, depending on the needs of the judicial system and changes in caseloads.

Learn more about Congress determines number of federal courts here:

https://brainly.com/question/32252422

#SPJ6

Which of the following people did NOT contribute to the field of sociology? (1 point)
Tennessee Williams
Emile Burkheim
Karl Marx
Max Weber

Answers

Tennessee Williams was a playwright
Emile Durkheim was a sociologist 
Karl Marx was a philsopher
Max Weber was a sociologist.

The first answer is correct.

Tennessee Williams was one of the most important North American playwright of the twentieth century. Williams wrote dramas and plays of world-wide success, receiving diverse prizes and having diverse works that served as base for diverse cinematographic versions. However, his work is not associated with Sociology.

Following World War II, how did the world’s leaders promote peace and reduce poverty?

Answers

Post-World War II, world leaders advanced peace and poverty reduction efforts through international cooperation, the United Nations, economic aid like the Marshall Plan, and domestic programs to alleviate poverty. Technological advancements in shipping further facilitated global trade, contributing to economic growth. Social movements also influenced these efforts, emphasizing the importance of social justice and security.

Following World War II, world leaders undertook various strategies to promote peace and reduce poverty. Official development assistance, often referred to as aid, was a significant approach that involved the redistribution of resources from wealthier countries to developing nations. Additionally, international alliances such as the United Nations were formed to foster international cooperation. The United States, having emerged economically robust, played a pivotal role in shaping the post-war order, implementing strategies like the Marshall Plan to aid in Europe's recovery and economic prosperity.

Another critical mechanism for achieving post-war recovery was the transformation of war economies into consumer economies, notably in the United States, which experienced a substantial surplus in trade balance. Facilitating global trade, technological innovations like the freight container revolutionized shipping, making it more efficient and reducing costs. Moreover, in the domestic sphere, America's war on poverty in the 1960s demonstrated a significant decline in poverty rates through government programs and policies.

Peace movements also played a role, with organizations such as the Women's International League for Peace and Freedom influencing social dimensions of peace and advocating for issues of social and economic justice. European nations echoed a similar sentiment, prioritizing material and social security as essential components for a peaceful environment.

Which event helped soldiers returning from World War II reintegrate into US society?

Answers

GI Bill (1944)offically known as the Servicemen's Readjustment Act, this law helped returning World War II soldiers reintegrate into civilian life by securing loans to buy homes and farms and set up small businesses and by making tuition and stipends available for them to attend college and job training programs; it was also intended to cushion the blow of 15 million returning servicemen on the employment market and to nurture the postwar economy

Answer:

The Servicemen's Readjustment Act of 1944, commonly known as the G.I. Bill, was a law that provided a range of benefits for returning World War II veterans. T

Explanation:

GI Bill (1944)offically known as the Servicemen's Readjustment Act, this law helped returning World War II soldiers Officially the Servicemen's Readjustment Act of 1944, the G.I. Bill was created to help veterans of World War II. It established hospitals, made low-interest mortgages available and granted stipends covering tuition and expenses for veterans attending college or trade schools.

Management guru Peter Drucker said that providing free higher education to so many Americans changed the world by creating the modern knowledge economy

America's victory in the Revolutionary War was made more probable for the following four factors:

because George Washington was an excellent leader
through money, supplies, soldiers, and ships that were presented through foreign aid from France
because of serious blunders on the part of the British commanders
because the colonists were courageous in fighting for a cause in which they believed
because England hired the Hessian mercenaries

Answers

As far as I undersrood there can be more than one correct so, I consider these options as the most accurate :
because George Washington was an excellent leader
through money, supplies, soldiers, and ships that were presented through foreign aid from France

because the colonists were courageous in fighting for a cause in which they believed 

I'm sure it helps! Regards.
ALL of these factors contributed to America's success, EXCEPT:
1. because of serious blunders on the part of the British commanders
2. because England hired the Hessian mercenaries

1. Why did Japan conquer other countries and territories in the 1930s?
It wanted access to resources and materials.
It believed other countries should become democracies, too.
It wanted a stepping-off point for invading the United States.

Answers

It wanted access to resources and materials.
it wanted a stepping-off point for invading the United states

Which of the following statements describes the corruption in the South during Reconstruction? It took place in railway bonds. It took place in construction contracts. It took place in land sales. All of the above.

Answers

Thank you for posting your question here at brainly. I hope the answer will help you. Feel free to ask more questions.

All of the below statements describes the corruption in the South during Reconstruction, therefore the answer is all of the above.


It took place in railway bonds.
It took place in construction contracts.
It took place in land sales.

Which institution served as the main unifying force of medieval western europe?

Answers

The Catholic Church served as the main unifying force of medieval western Europe.

Final answer:

The main unifying force of medieval Western Europe was the Roman Catholic Church. It maintained cultural and intellectual continuity post-Roman Empire and was the central spiritual authority with a significant influence over Europeans' daily lives. Its organized structure and hierarchical system enabled it to unify a politically fragmented Europe.

Explanation:

The institution that served as the main unifying force of medieval Western Europe was the Latin Church, more commonly known as the Roman Catholic Church. After the fall of the Western Roman Empire, the Church not only united Western Europe but also preserved the legacy of Roman institutions, law, and language, which were fundamental to the cultural and intellectual life of the Middle Ages. Its spiritual authority and organizational structure allowed it to maintain a significant influence over the daily lives of Europeans, setting a basis for shared European identity despite political fragmentation.

With its center in Rome and the Pope as its head, the Roman Catholic Church represented the most powerful international organization in Western Europe during this period. It oversaw a hierarchical structure with cardinals, archbishops, bishops, and priests, which maintained a strict organizational framework across diverse regions. This centralization of spiritual authority stood in contrast to the more fragmented political landscape characterized by the Holy Roman Empire and various regional powers.

Later, during the 13th century, the unified nature of the Church, as well as its multinational bureaucracy, allowed it to consolidate more influence compared to temporal feudal lords. The Church's relationship with the populace through parishes and the spiritual guidance it provided further cemented its place as the core unifying institution of the era, even shaping the evolution of European society and politics well into the future.

Which is not a responsibility of a county government

Answers

since you provide no options, here are a few responsibilities of a county government :

- Maintaining public properties such as roads and public parks
- Operate the judicial system and provide law enforcement
- Maintaining public records
- conducting elections

your answer probably the one that's not included above, hope it helps 

Answer:

Regulate local national guard is not a responsibility of a county government.

Explanation:

cleisthenes is known as the what father

Answers

The father of democracy!
The Father of Democracy!

which prince of kievan investigated various religions and then choose eastern orthodox christianity as the state religion

Answers

The answer to your question will be Vladimir the great.

Which of the following is most similar to the background story and effects of the Treaty of New Echota, just with a different group of people in a different place?
A. Treaty of Moultrie Creek
B. Treaty of Payne's Landing

Answers

The correct answer for this question would be option B. The one that is most similar to the background story and effects of the Treaty of New Echota, just with a different group of people in a different place is the Treaty of Payne's Landing. Both stories include signing a treaty between the government of United States and a representative from that place. Hope this answer helps.

What is one of the most popular christmas tree ornaments in japan?

Answers

in Japan, tinsel is one of the most popular Christmas tree ornaments.

which of the following describes a similarity between China's Tang and Song dynasties in the post-classical era
A) Both relied on maritime trade instead of land-based routes
B)Both isolated china from its neighbors to protect its culture
C) Both grew wealthy through trade along the Silk Road
D) Both fiercely persecuted religious and ethnic minorities

Answers

I strongly believe the answer is C. Because they both became the richest and most powerful country.

Answer:  The correct answer is : C) Both grew wealthy through trade along the Silk Road

Explanation:  The silk route was very important because in addition to being a commercial route, it transmitted ideas such as Buddhism, Christianity and Islam. Technical knowledge was also extended, such as iron manufacturing, well drilling, powder and paper manufacturing and printing techniques. The three largest groups that traded along the silk route were: the Mediterranean, Central Asia and Western Asia.

The legislative branch is

Answers

The legislative branch is made up of the two houses of Congress—the Senate and the House of Representatives. The most important duty of the legislative branch is to make laws. Laws are written, discussed and voted on in Congress. There are 100 senators in the Senate, two from each state.

Hope this helps :)
The branch of government composed of the House of Representatives and Senate. This branch is responsible for creating laws and declaring war. 

Why was galileo accused of being a heretic?

Answers

Galileo was ordered to turn himself in to the Holy Office to begin trial for holding the belief that the Earth revolves around the Sun, which was deemed hereticalby the Catholic Church. Standard practice demanded that the accused be imprisoned and secluded during the trial. hope this helps

Galileo was accused of heresy because his support for the heliocentric model contradicted the Church-endorsed geocentric view. The Church found his teachings directly opposed to Scripture and threatening to its authority, resulting in his trial during the Inquisition and subsequent house arrest.

Galileo was accused of heresy by the Roman Catholic Church primarily because his support for the Copernican heliocentric model contradicted the longstanding Aristotelian and Ptolemaic geocentric views, which were endorsed by the Church. In their eyes, his teachings were conjectured to be against the Scripture.

During the Inquisition, Galileo was found guilty of heresy for holding the belief that the Earth moved around the Sun and was not the center of the universe, a view which was in direct contradiction with the Church's teachings at the time. Furthermore, the prohibition of 1616 declared the Copernican doctrine to be 'false and absurd' and not to be held or defended.

Galileo's embracing of the heliocentric view and his public lectures and writings in Italian (rather than the scholarly Latin), were seen as challenges to both the scientific and scriptural authority of the Church. His audacious stance not only threatened established religious doctrine but also the Church's political and economic power. The Church, while not requiring a literal interpretation of the Bible, actively censored Galileo's ideas until 1836, and only admitted to the error in censoring his work in 1992.

Though some suggest that Galileo's issues with the Church might have partially stemmed from personal enmities and his satirical writing style, it is clear that his scientific propositions and their perceived challenge to Church doctrines played a significant role in his persecution. Galileo was placed under house arrest, where he continued his research and correspondence, demonstrating a resilient spirit despite his circumstances.

How does voting ensure "the consent of the governed"?

Answers

the answer is basically in the phrase. The government allows the people, or "governed" to choose who they want to elect. This choice shows that we give permission, or consent, to the chosen electee.


Which statement about the Qur’an is true?


It is a collection of Muhammad’s revelations.

It was compiled by Muhammad after Gabriel’s visit.

It is only considered authentic in its Arabic form.

It is a book of Islamic law that is used to establish rules.

Answers

It can be that all of the above are correct, but for the sake of your test or homework the correct answer should be It is a collection of Muhammad’s revelations.

Choose the propaganda style that best fits the statement below.

"Governor Lewis has raised taxes, increased poverty and stolen from you, the American people".

glittering generalities
name calling
plain folks
card stacking
bandwagon
patriotism
testimonials

Answers

nameeeee caaaaaalling

Answer:

Name Calling

Explanation:

The statement in the question shows a negative reaction to the Lewis Government. This statement accuses him of creating bad and disastrous things for society. This type of propagating is known as name calling, which is characterized as a rude and derogatory language, which criticizes a political figure and tries to associate it with something bad, negative, that causes discomfort.

The constitution was completed in 1776. true false user: by the end of the convention, 39 delegates signed the constitution. true false

Answers

The constitution was completed in 1776. False. 
By the end of the convention, 39 delegates signed the constitution. True. 

The chef touches raw sausage and then touches toasted bread ?

Answers

e coli or salmonilla
Final answer:

Cross-contamination can occur when touching raw sausage and then touching toasted bread, potentially leading to the transfer of harmful bacteria.

Explanation:

Help?
Identify three major problems faced by farmers after the Civil War. Explain how farmers organized to address these problems.

Answers

The three major problems would be:
1)falling prices for crops
2)higher prices for transportation
3)poor harvest.
The farmers organized the Grange Movement to get the government to establish the ICC to oversee Interstate Transportation, and Grange laws were made to set a maximum rate for grain storage and shipping rates. This Grange also allowed farmers to learn new farming techniques



To punish the city of Boston for its infamous Tea Party, Parliament passed the:

Stamp Act
Intolerable Acts
Townshend Program

Answers

The best and most correct answer among the choices provided by your question is the second choice.

To punish the city of Boston for its infamous Tea Party, Parliament passed the Intolerable Acts.

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
Other Questions
Second grade homework easy!!!! Plz answer 15 pointsThx "lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. Steam Workshop Downloader