Answer:
The rough endoplasmic reticulum
Explanation:
The rough endoplasmic reticulum has structures called ribosomes attached to them. Proteins which are to be made and transported are made in the ribosomes of the rough endoplasmic reticulum. The proteins are made by the ribosomes and modified by the rough endoplasmic reticulum. From the rough endoplasmic reticulum, the proteins move to the Golgi complex where they are packages to be moved. GPCRs proteins are also produced by the rough endoplasmic reticulum just like the other proteins.
Assembling a complete sequence from fragment sequences
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?
Enter the complete DNA sequence, which should contain 24 bases.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The bacteria grown in Luria broth with only lactose were expected to: Select one: a. Grow much faster than those grown in Luria broth and glucose. b. Mutate at a higher frequency than those grown in luria broth and glucose. c. Search for another carbon source. d. Show marked B-galactosidase activity. e. Show no B-galactosidase activity.
Answer:
Option D is correct
Explanation:
Luria broth contains yeast concentrate so it would show a marked B- galactosidase activity which is an enzyme that catalyzes the hydrolysis of B- galactosides including lactose and it is the first step of lactose fermentation.
Answer:
D. Show marked B-galactosidase activity.
Explanation: Bacteria are Microorganisms which can be very infectious.
Luria broth also called luria bertani broth, lysogenic broth are very rich Nutrition where certain Bacteria grow it is used generally for bacterial cultivation and growth, it has been known to support the growth of many bacteria such as Escherichia coli to an optical density of up to 600nm. Industrially,it is widely used for cultivation of Escherichia coli species.
20 different ___ ___ link together to form chains. A protein is composed of one or more of these ___ chains which are twisted and folded into a particular shape.
Answer: Amino acids; peptide
Explanation:
20 different AMINO ACIDS link together to form chains. A protein is composed of one or more of these PEPTIDE chains which are twisted and folded into a particular shape.
There exists 20 amino acids capable of forming protein in the Human body. At least two amino acids are joined together by a peptide bond to form polypeptide chains that are then held together by hydrogen bonds in twisted alpha helical structures to form proteins.
Answer:Amino acid, polypeptide/polynucleotide chains
Explanation: Amino acids are usually the building blocks of protein hence,every protein is made up of one or more amino acids.
A protein consist of one or more polypeptide chain that is folded into a helix shape. This shape is to prevent the easy degradation of the components that makes up the polypeptide because it is water loving and can easy degrade.
Considering an X-linked dominant trait, if an unaffected woman and an affected man decide to have children, which of the following statements is TRUE about the possibilities for their children?
a. Their sons are expected to be heterozygous for the associated gene.
b.Their daughters are expected to be heterozygous for the associated gene.
c. All their children, whether male or female, are expected to show the dominant trait.
d. All of their sons are expected to show the dominant trait.
e. Their daughters are not expected to show the dominant trait.
Answer: B - Their daughters are expected to be heterozygous for the associated gene.
Explanation: In X - linked dominant trait,
1. Both males and females are affected; often more females than males are affected.
2. Affected fathers will pass the trait on to all their daughters.
3. Affected sons must have an affected mother.
4. Affected daughters must have either an affected mother or an affected father.
5. Affected mothers (if heterozygous) will pass the trait to ½ of their sons and ½ of their daughters.
Check the attached image to see the illustration of how an X - linked trait can be passed from an affected father and unaffected mother to their offspring.
Many researchers think that the first eukaryotic cells obtained energy for life-sustaining functions from organic compounds. Given this information, which of the following organelles most likely appeared last in eukaryotic cells?
a.plasma membrane
b.chloroplast
c.ribosome
d.nucleus
Answer: Chloroplast
Explanation:
The presence of chloroplast would have been the last organelle which appeared in the eukaryotic cell. Chloroplast helps in photosynthesis which means prepare food from the inorganic compounds.
But here the cell obtains energy from the organic compounds which states that there is no need of chloroplast in the cell as they obtain energy by hetero tropic mode of nutrition.
Hence, chloroplast is the correct answer.
The semilunar valves of the heart open at the onset of the ejection period. Approximately what percentage of the stroke volume is ejected during the first quarter of systole?
The percentage of the stroke volume is ejected during the first quarter of systole will be approximately 60% to 65%
Explanation:
The time interval between the atria contraction and the relaxation of ventricles are called as a Cardiac cycle. Systole denotes the heart contraction during the blood pumping. Diastole refers to the heart relaxation when the blood is filled in the heart chambers. The total blood is not fully pumped by the ventricles.
Instead they will pump only a proportion of blood in each of the cardiac cycle. The ejection fraction refers to the proportion of the intraventricular volume that is received as a output in circulation process. A human with normal heart functioning can have approximately 60-65%. This is known to be stroke volume. The blood volume that is ejected is strove volume.
Billy Smart had been experiencing ophthalmalgia since completing a deck in his backyard. He asked his optician about it and she suggested Billy see an ophthalmologist. Ophthalmoscopy revealed a small cut on the eye's surface (the cornea), and antibiotics were prescribed. What is ophthalmoscopy?
Answer:
Ophthalmoscopy is also known by the name funduscopy is used to look into the different eye structure especially in the fundus region. This is involved in the normal physical examination.
During the examination, the complete information about vitreous humor, retins and discs can be understood by opthalmoscopy. The individual have any problem in the eye and its cure can be done by the ophthalmologist. In case of any eye emergency the individual must go for theopthalmoscopy.
If you touch a hot stove, your spinal cord can prompt you to withdraw your hand without having to send the message all the way to the brain. This is due to what scientists call __________.
Answer:
The reflex arc
Explanation:
The reflex arc is a pathway in which sensory receptors sense the stimulus and the sensory neurons carry the sensory information to the spinal cord. Here, the spinal cord serves as the integrating center. It sends the motor information via motor neurons to the effector organs. This pathway followed by nerve impulses is called reflex arc in which the information is not sent to the brain for processing. This allows a quick generation of responses called reflexes. Touching a hot stove is sensed by the thermoreceptors of skin and the information follows the reflex arc to generate response.
The phenomenon described is a reflex arc, an automatic response to a specific stimulus that bypasses the brain to quickly prompt a reaction, like withdrawing a hand from a hot stove.
Explanation:What you're referring to is what scientists call a reflex arc. A reflex arc is an automatic, involuntary response to a specific stimulus, such as pain from touching a hot surface. Unlike other types of nerve signals, the signals from a reflex arc don't need to go all the way to the brain to be processed. Instead, the signal goes to the spinal cord, which then sends a signal back to the muscles, prompting you to draw your hand away. This bypass of the brain helps speed up response time, which can be crucial in preventing injury.
Learn more about reflex arc here:
https://brainly.com/question/32286035
#SPJ12
What is the expected outcome if DNA from an ampicillin resistant organism is incorporated into an ampicillin sensitive organism by transformation and then the resulting organisms are allowed to reproduce on agar containing ampicillin?
Answer:
Only transformed cells will grow on agar containing ampicillin.
Explanation:
If the DNA from an ampicillin-resistant organism is incorporated into an ampicillin sensitive organism then the transformed ampicillin sensitive organism will get ampicillin resistant gene.
So when this transformed organism will allow growing on the agar containing ampicillin then this transformed organism will easily grow and reproduce on agar containing ampicillin because now it has an ampicillin-resistant gene which will protect it from ampicillin antibiotic. So the transformed cell will grow on agar containing ampicillin.
Help!! I'm stuck on this....
Suppose a stream has a low volume but a steep gradient. How might the
stream change the land? Provide your reasoning.
Answer:
The steep gradient causes the erosion of soil.
Explanation:
Steep gradient is the slope of the land where the stream is present or any flow of runoffs.As the slope of stream flowing increases, the velocity of water also increases causing the erosion of soil.It causes the land to get deformed by the sweeping of soil making difficult for plants and grasses.The steep gradient runoffs negatively impacts the aquatic living thing.A low-volume stream with a steep gradient can change the landscape through erosion and sediment transport, forming features such as gorges, ravines, and river terraces over time.
Explanation:Even a stream with a low volume but a steep gradient can significantly change the land. The steep gradient means the stream flows rapidly, creating a powerful force that can erode soil and rocks, transporting them downstream. This process can form features such as gorges and ravines.
Over time, this constant erosion and sediment transport can remodel the landscape, deepening valleys and altering the course of the stream. On a smaller scale, it may also create river terraces, which are flat areas alongside the stream where sediments accumulate.
Learn more about Erosion and Sediment Transport here:https://brainly.com/question/32312372
#SPJ3
Teleological moral theories are also known by the term a. nonconsequentialist. b. deontological. c. consequentialist. d. epistemological.
Answer:
C. consequentialist
Explanation:
Teleological Ethical Theories deals with the aftermath of actions I.e. the primary guidelines for our actions as either morally right or wrong relies on the good or evil results it produced.
The term Teleological is a Greek word telos, “end” and logos, “science”.
Consequentialism believes the results of one's actions are the ultimate reason for concluding on the rightness or wrongness of that action. A consequentialist views a morally right action on the good outcome or consequence that results from it.
Take for example, some view lying as wrong. But if telling a lie is necessary to redeem or save a person's life from certain situations, consequentialism holds the belief that it is the best thing to do.
Final answer:
Teleological moral theories focus on the consequences of actions and are also known as consequentialist theories.
Explanation:
Teleological moral theories are a group of ethical theories that regard the consequence or the purpose of actions as the basis for determining their moral value. These theories contrast with deontological theories, which argue that actions are right or wrong in themselves, irrespective of their consequences. The term "teleological" is derived from the Greek word "telos," which means "end" or "purpose." Therefore, the correct answer to the question of which term is also known for teleological moral theories is c. consequentialist. Bentham's Utilitarianism is an example of a consequentialist theory because it judges the morality of an action by its outcomes, specifically, by whether it maximizes pleasure or happiness.
Muscle cell activity increases and ATP decreases below the set-point, a sensor molecule detects low ATP and activates protein kinase A, protein kinase A activates protein kinase B, protein kinase B activates transporters that absorb glucose into the cell, glucose is metabolized. This is a _________.
Answer: Feedback mechanism
Explanation:
Feedback mechanism is the body's way of maintaining physiologic processes in the body. These physiologic processes include maintaining homeostasis, production of energy, hormones as well as enzymes required for chemical reactions.
There are 2 types of feedback mechanism:
Positive feedback: The stimulus (message) sent to the brain, produces prolonged increased production or increased activity in the body.Negative feedback: In negative feedback, the stimulus causes production, secretion or activity till a set point where the body knows it has taken enough. This causes a self termination of the process.In the increased muscle activity, the increase in activity in turn causes a decrease in energy (ATP) and serves as the stimulus leading to the release of enzymes which in turn lead to increased absorption of glucose which will be used by the body to produce more ATP needed for the muscular activity. At the end of the muscular activity, the body recognizes that it doesn't need an increased absorption of glucose to support increased activity anymore and glucose absorption normalizes.
Pedalfer soils would most likely be found _____. A. in the eastern half of the United States B. in the dry areas of the western United States C. in a tropical rain forest D. on an island close to the equator
Answer:
Pedalfer soils would most likely be found in the eastern half of United States
Explanation:
The climate in the eastern half of the US is humid and rainy. When leaves of trees fall off during an extreme rainfall event, leaves mix up with soil to produce padalfer soil. The word padalfer is based on the two elements is (aluminum and ferrous) that are commonly present in this soil type. These elements join the soil because of these biogeochemical cycles. This is also the reason that the word "padalfer", contains Al and Fe.
PROTOZOAN CULTURES- Submit your observations.
Protozoans are single celled eukaryotes that exhibit plant and animal like features. Some of the examples of protozoans are - Euglena, Paramoecium and Amoeba. To observe these organisms under the microscope, a small amount of it from the culture jar is taken and observed at different magnification. Euglena moves with the help of a flagella and hence, is classified as flagellate. Paramoecium moves with the help of cilia and hence, classified into ciliate. Amoeba moves with the help of pseudopodia and thus, it is a sarcodine.
All the three organism has nuclei. However, paramecium have two nuclei called as a micronucleus and macronucleus. Euglena lacks food and contractile vacuole. Euglena also has an organelle called as chloroplast which is found mostly in plants.
TOne possible conclusion that can be drawn about the activity of these two cells is that
(1) more active transport occurs in cell B than in cell A
(2) more active transport occurs in cell A than in cell B
(3) cell B uses some of the extra mitochondria to make food
(4) cell A is a plant cell since it has a cell wall Mitochondria Cell
Answer:
(2) more active transport occurs in cell A than in cell B
Explanation:
I suppose you meant the cells picture I attached.
(1) more active transport occurs in cell B than in cell A;
Active transport is the movement of molecules across a membrane from a region of lower concentration to a region of higher concentration. For this movement to occur, it requires cellular energy. From the diagram, cell B possess less mitochondria than cell A.
(2) more active transport occurs in cell A than in cell B;
From the above explanation, it is clear that cell A possess more mitochondria than cell B, active transport moves against a concentration gradient and therefore require energy which must be supplied by the cell. Due to this the cells capable of active transport usually have more mitochondria, in which respiration takes place than other cells.
(3) cell B uses some of the extra mitochondria to make food
From the diagram, it does not indicate the cell using any extra mitochondria to make food. Mitochondria produce energy by cellular respiration.
(4) cell A is a plant cell since it has a cell wall Mitochondria Cell
Animal cells do not have a cell wall but have a cell membrane. Plant cells have a cell wall composed of cellulose as well as a cell membrane; however, from the diagram, this information is invalid.
Homologous chromosomes:
a. carry genetic information that influences the same traits.
b. are genetically identical.
c. are inherited only from the mother.
d. are members of different pairs.
Answer:
a. carry genetic information that influences the same traits.
Explanation:
Homologous chromosomes are the pairs of chromosomes. One chromosome of a pair is derived from the egg cell while the other comes from sperms. Two chromosomes of a pair carry the gene for the same traits. For example, two copies of chromosome 21 would carry the genes for the same traits in humans. However, these two chromosomes of a homologous pair may have the same or different alleles for a particular gene.
If chromosome 21 carries the gene for eye color in humans, the paternal chromosome may have the allele for blue eyes while the maternal chromosome may carry the allele for the black eyes. However, both of them have the "gene for the same traits (eye color)".
Homologous chromosomes carry genetic information influencing the same traits, thus option a is correct. They are not genetically identical, only inherited from the mother, or members of different pairs, making options b, c, and d incorrect.
Explanation:Homologous chromosomes are pairs of chromosomes in a somatic cell, one of which is inherited from each parent. These chromosomes carry genetic information that influences the same traits, which is option a. They are not necessarily genetically identical, as one inherits different versions of the same gene, known as alleles, from each parent. Therefore, option b is incorrect. They certainly are not inherited only from the mother, which dismisses option c. Lastly, homologous chromosomes are members of the same pair, not different pairs, so option d is incorrect as well.
Learn more about Homologous chromosomes here:https://brainly.com/question/33380808
#SPJ3
Following knee replacement surgery 10 days earlier, an older adult client diagnosed with an infection in the knee has a synovial fluid culture ordered. Obtaining the sample helps to determine the causative microorganism and to select an appropriate antibiotic. The above course of events characterizes what major belief system? A. Holistic paradigm B. Scientific paradigm C. Analytic paradigm D. Magico-religious paradigm
Answer:
The correct option is B) Scientific paradigm
Explanation:
The scientific paradigm focuses on the infection and the microorganism for the occurrence of the infection. A scientific paradigm also refers to the treatment of these infections through pharmaceutical or surgical approaches. Hence, option B is correct.
Other options, like option A, is not correct because a holistic paradigm focuses on the connection between the mind, body and the soul. Option C is false because the analytical paradigm is not a part of the major health belief system.
In the 1800s the most widely favored explanation of genetics was "blending." Explain the concept of blending, and then describe how Mendel’s "particulate" (gene) hypothesis was different.
I need the answer to!!!
A PICC line is a short catheter inserted into the jugular vein. A PICC line is a catheter that allows for infusion of intravenous fluids without an infusion pump. A PICC line is a long catheter inserted through the veins of the antecubital fossa. A PICC line is a catheter that is used for emergent or trauma situations.
Answer:
A PICC line is a long catheter inserted through the veins of the antecubital fossa.
Explanation:
PICC (peripherally inserted central catheter) that are mainly used as a part of chemotherapy for the administration of the particular substances. This can be used for the long period of time in the individual.
The long catheter is inserted in the body through the skin mainly at the peripheral site of the body. This can be inserted for the weeks depending on the severity of treatment. The veins of the antecubital fossa is used for the insertion of the tube.
Thus, the correct answer is option (3).
Answer:
C
Explanation:
Functional magnetic resonance imaging scans provide computer-generated images of brain structures and activities by aiming a powerful magnetic field at the body.
1. True
2. false:
Answer: True
Explanation:
The magnetic resonance imaging scans provide the picture of the body. This image is computed image of the body.
The MRI scanners use the strong magnetic field in order to obtain the image of the body and organs.
This image is used to detect the problems in the body which can be cured using certain medications if detected on time.
Which perspective assumes that human behavior may have developed in certain directions because it served a useful function in preserving the species?
Answer:
656
Explanation:
You decide to try your hand at canning pickles. You immerse freshly picked cucumbers in a solution that has a solute concentration twice that found in the cucumber cells. You allow your preparation to cure for several months in a sealed jar. When you later open the jar, you find that the fluid surrounding the pickles is more dilute than when you started.This change in concentration is due to_____.
Answer:
Exosmosis of water from cucumber cells into the fluid.
Explanation:
The solute concentration of the fluid in which cucumbers were immersed was higher than that of the cucumber cells. This means that the fluid was hypertonic with respect to the cucumber cells. This allowed movement of water from the hypotonic cucumber cells towards the hypertonic surrounding fluid. The process is called exosmosis with respect to cucumber cells. The loss of water from the cucumber cells by the process of osmosis diluted the surrounding fluid.
With an apical four-chamber view, the left ventricle is generally the same size as the right ventricle. A. True B. False
Answer: The statement is false
Explanation:
The wall of the left ventricle is thicker and more muscular than that of the right ventricle, this is because it is through the left ventricle that blood is pumped out of the heart to all parts of the body.
Therefore, the left ventricle is NOT the same size as the right ventricle
The statement "With an apical four-chamber view, the left ventricle is generally the same size as the right ventricle" is
B. False.
In an apical four-chamber view of the heart, the left ventricle is generally not the same size as the right ventricle.
The left ventricle is larger and has thicker walls compared to the right ventricle. This is because the left ventricle needs to pump blood to the entire body through the systemic circuit, which requires more force, while the right ventricle pumps blood to the lungs through the pulmonary circuit, which is a shorter distance and requires less force.
A researcher is studying phases of the cell cycle in a population of cells during which there is an increase in the DNA content. This stage is most likely:
Answer:
Interphase
Explanation:
The cell cycle is the series of events that occurs in a cell leading to its division. It is characterized by two main phases viz: Interphase and the Mitotic (M) phase.
The Interphase also called the resting phase is the phase that occurs between two successive divisions of the cell. It is that time where the cell prepares, grows and duplicates its genetic material (DNA). The duplication or replication of DNA occurs specifically in the S-phase or Synthesis phase of the interphase, in which the molecules of DNA in the chromosomes doubles, hence, increasing its content.
It is pertinent that DNA doubles in the cell prior to division (mitosis) because each resulting daughter cell needs to contain an equal and correct amount of genetic material as the parent cell.
Therefore, according to the question, the cell will likely be at the Interphase stage of the cell cycle since Its genetic material has increased.
A young student is trying to recapitulate an experiment discussed in the text. She introduces single-celled green algae into a petri dish containing predatory protists. After several generations, what will she observe?
A)The protists will produce multicellular colonies.
B)Green algae will form multicellular colonies.
C)Green algae will remain unicellular (i.e., there is no benefit to forming multicellular structures).
D)Both protists and green algae will remain unicellular.
E)None of the answer options is correct.
She will observe that Green algae will form multi-cellular colonies.
Explanation:
There are different advantages that can be obtained from the characteristics of multicellularity of algae. The main thing that is very essential for the the nature of multicellularity is the coordination and cell interaction in algae. The cell communication can be achieved by the transfer of materials of cytoplasm.
The cellcommunication can also be achieved through the molecules that are diffusible in nature. these are are the unique and common characteristics of the organisams that are multicellular. They will be following a varied pattern of cell growth and cell division to form colonies.
Muscle cell activity increases and ATP decreases below the set-point, a sensor molecule detects low ATP and activates protein kinase A, protein kinase A activates protein kinase B, protein kinase B activates transporters that absorb glucose into the cell, glucose is metabolized. This is a:_______.
Answer:
Negative feedback mechanism
Explanation:
A negative feedback mechanism occurs when there is some change in the homeostatic conditions of the body. These changes are sensed as stimuli and the desired response is generated to oppose the change and to restore the original condition. In the given example, the reduced levels of ATP in muscle cells during increased muscular activity are sensed as a stimulus. The body restores the ATP levels by stimulating the absorption and metabolism of glucose by the cell. Therefore, it represents a negative feedback mechanism.
Gap junctions allow direct communication or ionic flow between adjacent cells for a(n) ________ synapse, while synapses that use neurotransmitters to signal from the presynaptic to postsynaptic cell are called ________.
Answer:
1. Electrical synapse
2. Chemical synapse
Explanation:
The nervous system is composed of the billions of neurons which communicate with each other through the generated nerve impulse. The transmission of the nerve impulse depends on the movement of ions which generate an electric impulse.
The impulse is passed from one neuron to another neuron through the neuronal gaps called synapses.
The neurons which transmit the signal in the form of the electrical signal through the gap junctions between the neurons which allow the direct transmission of the signal. The synapse in such neurons is known as an electrical synapse.
The neurons which transmit the signal by converting the electrical signal to chemical signal in the form of neurotransmitter contain the synapse called chemical signals.
Thus, Electrical synapse and Chemical synapse are correct.
Gap junctions enable direct electrical communication between cells in an electrical synapse, often found between certain interneurons and glial cells, whereas chemical synapses use neurotransmitters to facilitate intercellular communication.
Explanation:Gap junctions allow direct communication or ionic flow between adjacent cells for a(n) electrical synapse, while synapses that use neurotransmitters to signal from the presynaptic to postsynaptic cell are called chemical synapses. Gap junctions are created by pairs of hemichannels, which are made up of connexin proteins.
These junctions permit the flow of cations, anions, and even small molecules such as ATP between cells, allowing for direct electrical signal propagation. Electrical synapses facilitated by these gap junctions are vital for certain interneurons in the brain and the retina as well as between glial cells like astrocytes. Whereas chemical synapses involve the release of neurotransmitters from the presynaptic cell which then bind to receptors on the postsynaptic cell, initiating a response.
Neurons are the central building blocks of the nervous system. A neuron’s outer surface is made up of ______________ which allows smaller molecules and molecules without an electrical charge to pass through it, while stopping larger or highly charged molecules.
Answer:
semipermeable membrane
Explanation:
Neurons are the cells of the nervous system and have the plasma membrane as their outer covering. Their plasma membrane is also made up of two layers of phospholipids and the proteins are embedded in it. Therefore, the plasma membrane of neurons is a semipermeable membrane as charged and polar substances can not cross its nonpolar core made up of the hydrophobic tails of the phospholipids.
Similarly, the substances with a larger size can also not move freely across it. A semipermeable membrane allows only certain substances to move through it.
You run a PCR reaction for five cycles starting with a single DNA duplex. Theoretically, how many copies of your sequence would you now have?
8
24
12
16
32
Answer:
32
Explanation:
PCR is a technique that amplifies a small DNA sample. When a single molecule of a double-stranded DNA enters the first round of PCR, each of the two strands of the DNA serves as a template and results in the formation of two new DNA molecules. If the second round of PCR is performed and both molecules of DNA enter it, each of them would be amplified into two DNA molecules. So, there are 4 DNA molecules by the end of the second round of PCR. If five rounds of PCR are carried out starting with a single DNA molecule, a total of 2^5= 32 DNA molecules will be obtained at the end.
Final answer:
After five cycles of PCR reaction starting with a single DNA duplex, you would theoretically have 32 copies of the DNA sequence, as PCR doubles the number of copies with each cycle.
Explanation:
If you run a PCR reaction for five cycles starting with a single DNA duplex, each cycle will double the number of copies of your sequence. This is because the PCR process, which consists primarily of the steps of denaturation, annealing, and extension, doubles the amount of double-stranded target DNA with each cycle. So, starting with a single DNA duplex, after one cycle there would be 2 copies, after two cycles there would be 4 copies, and this doubling continues with each cycle. Following this pattern:
After the 1st cycle: 2 copies
After the 2nd cycle: 4 copies
After the 3rd cycle: 8 copies
After the 4th cycle: 16 copies
After the 5th cycle: 32 copies
Theoretically, you would have 32 copies of your sequence after five cycles of PCR.
You have a population of 1000 people, and you are looking at the population genetics of a blood marker that has two alleles. The dominant allele (Y) makes the protein, and the recessive allele (y) does not make the protein. When you test the blood of the population, you find: 490 people have the genotype YY. 420 people have the genotype Yy. 90 people have the genotype yy. What are the allele frequencies (Y and y)?
Answer:
the allele frequencies (Y and y) = 0.7 and 0.3
Explanation:
Total population = 1000
p² = 490 people have the genotype YY
2pq = 420 people have the genotype Yy.
q² = 90 people have the genotype yy.
What are the allele frequencies (Y and y)?
To calculate the allele frequencies , we need to go by Hardy Weinberg's principle;
p + q = 1
p² + 2pq + q² = 1
p is the frequency of the dominant allele.
q is the frequency of the recessive allele.
p² is the frequency of individuals with the homozygous dominant genotype.
2pq is the frequency of individuals with the heterozygous genotype.
q² is the frequency of individuals with the homozygous recessive genotype.
Frequency of the individuals = [tex]\frac{individuals}{Total population}[/tex]
= [tex]\frac{490}{1000}[/tex]
p² = 0.49
To find p, we need to look for the square root of p²
p= [tex]\sqrt{0.49}[/tex]
p= 0.7
Using the first Hardy-Weinberg equation p + q = 1 to solve for q.
p + q = 1
q = 1 − p
q = 1 − (0.7)
q = 0.3
∴ the allele frequencies (Y and y) = 0.7 and 0.3