The correct answer is (c) Hide under a bridge or an overpass.
The important thing that one should never do when there is a Tornado is that one should never hide under bridge or an overpass. The high speed tornado can break the bridge and it will directly fall on you. Even if you escape from tornado by any means you will be in danger and die due to collapsed bridge or an overpass.
What is one major impact of seedless vascular plants?
The vascular seedless plants are utilized as the medicinal plant and fertilizer.
Further Explanation:
The vascular plants are those plants that possess xylem and phloem for the transport of water and food respectively. Plants that have vascular system but are seedless are the members of Pteridophytes.
The characteristics of Pteridophytes:
1. They are seedless and vascular cryptogams: They reproduces through the production of spores.
2. They show alternation of generation as the sporophytic generation alternates with the gametophytic generation: Sporophyte possess true root, stem and leaves.
3. Spores are developed in the sporangia. Both type of spores are developed- homosporous and heterosporous.
4. Sex organs are multicellular and are jacketed.
Some of the example of Pteridophytes are:
1. Equisetum
2. Salvinia
3. Dicksonia
4. Selaginella
The importance of pteridophytes:
1. They are used as cattle feed
2. They are used for medicinal purpose. For example the foliage decoction of Lycopodium is utilized in homeopathy to treat certain disease such as constipation, eczema, diarrhea and inflammation of liver. Equisetumcontains various flavonoid and saponina that have diuretic effect.
3. Marsilea contains starch and are consumed by people as food in some areas.
4. Aquatic pteridophyte such as Azollaare used as a very good biofertiliser.
Learn more:
1. Learn more about plant https://brainly.com/question/862697
2. Learn more about photosynthesis https://brainly.com/question/873199
3. Learn more about food https://brainly.com/question/1251757
Answer Details:
Grade: College Biology
Subject: Biology
Chapter: The Plant Kingdom
Keywords:
Vascular seedless, xylem, phloem, pteridophytes, sporophytic generation, gametophytic generation, Lycopodium, Marsilea, Azolla.
The processes of endocytosis and exocytosis both require?
Answer: Uses vesicles
Tortoises with long necks were found to be abundant in regions that had vegetation on a higher level. A few years later, drought hit the region and the vegetation dried up. Over time, grasses were observed in the region. Shortly thereafter, an increase in short-necked tortoises was observed in the region. What does this change in the species of tortoises suggest?
Answer:
A.
Changes in the environment give rise to evolution of species.
Explanation:
I just did this on PLATO and I got 100%
The change in the species of tortoises suggests natural selection, where tortoises with shorter necks became more abundant in a region with grasses after a drought.
Explanation:This change in the species of tortoises suggests natural selection at play. In the given scenario, tortoises with long necks were more abundant in regions with higher-level vegetation. This is because their longer necks allowed them to reach and access more leaves for food. However, when a drought hit the region and the vegetation dried up, grasses started to grow. As a result, short-necked tortoises had an advantage as they could easily access the grasses. Over time, these short-necked tortoises became more prevalent in the region.
similarities between outer planets and inner planets
The client newly diagnosed with type 2 diabetes mellitus eats a lot of pasta products, such as macaroni and spaghetti. the client is 40 pounds (18 kg) overweight. the client asks the nurse if pasta can be included in the diabetic diet. what is the best response by the nurse?
What does it mean when we describe water as being polar?
The fitt principle is applied to physical activity and exercise. what does fitt represent
The FITT principle represents Frequency, Intensity, Time, and Type, which are guidelines for creating an effective physical exercise program to enhance physical fitness and good health.
Explanation:The FITT principle is a set of guidelines that can help you structure a physical exercise program effectively. FITT stands for Frequency, Intensity, Time, and Type:
Frequency refers to how often you engage in physical activity or exercise.Intensity indicates how hard you exercise during a workout session.Time refers to the duration of each exercise session.Type means the kind of exercise you do to improve or maintain physical fitness and overall good health.Employing the FITT principle helps ensure that the workouts you perform are balanced and cover all aspects necessary for a comprehensive fitness program. This can include a combination of cardiovascular exercises, strength training, and flexibility workouts.
How would earth's atmosphere change if plants stopped carrying out photosynthesis?
Which trigonometric functions have asymptotes? (select all that apply.)?
Suppose an organism can alternate between aerobic and anaerobic respiration. if it had to use anaerobic respiration exclusively, how many glucose molecules must it break down to generate the same atp as it would in aerobic respiration?
What is the hallmark of our species, according to evolutionary psychologists?
The __________ skeleton is made up of 126 bones of the limbs and girdles.
Which of the following is generally true of female bones in relationship to male bones?
They are typically larger.
They are typically longer.
They are typically smoother.
They are typically spotted.
A student using a light microscope observes a cell and correctly decided that it is
A cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction. hints a cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction.
a. True
b. False
As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
a. breathing
b. the nitrogen cycle
c. the water cycle
d. cellular respiration
The hard and brittle outer layer of the Earth is known as the _______. A. core B. lithosphere C. atmosphere D. mantle
If ur doing studyisland the answer is (A) lithosphere
Which set of body parts does every mollusk have?
The body plan of a mollusk ordinarily comprised of a head region, a muscular foot, and a visceral mass of abdominal organs that are usually enclosed inside a dorsal shell. Each class holds some contrast on this primary plan.
The structure of the gastropod body is substantially comparable to the primary body plan of mollusks.
Most mollusks have a muscular foot for crawling or burrowing. Some mollusks also have a head with sense organs. The delicate body comprises lungs or gills to breath and digestive and generative parts, all surrounded by a covering like an organ known as the mantle.
The bony, spiral-shaped, fluid-filled sense organ used for hearing is the __________.
What is the basic structural unit of both dna and rna?
How do the atoms in diagram differ from those in diagram d
What has uekaryotik cells liver, virus, oak, lactobacillus?
The _____ body cavity is where the nerves of the spinal cord are located.
The circulatory system of organisms carries nutrients throughout that organism. Which cell structure has a similiar structure?
We have already talked about another class of chemicals that help send signals in the body – neurotransmitters. how are neurotransmitters and hormones similar and how are they different
Final answer:
Neurotransmitters and hormones serve as chemical messengers in the body, with neurotransmitters traveling short distances for precise communication between neurons, while hormones travel longer distances through the circulatory system to reach target cells. Neural messages are likened to train travel, limited to nerve tracts, while hormonal communication is akin to car travel, reaching any cell via blood flow. Neural messages are faster, whereas hormonal messages can lead to enduring changes.
Explanation:
Neurotransmitters and hormones both serve as chemical messengers in the body. Neurotransmitters are used by neurons and travel short distances to bind with receptors on postsynaptic neurons, while hormones enter the circulatory system to travel longer distances to reach target cells and bind with specific receptors.
Neural messages are like traveling on a train, limited to existing nerve tracts, while hormonal communication is compared to traveling in a car, able to reach any cell receiving blood via the circulatory system. The speed of neural messages is faster due to the short distance traveled, while hormonal messages can result in long-lasting changes throughout the body.
why are temperatures near the great lakes cooler in the summer than temperatures a few miles away?
EARTH SCIENCE
Answer:the lakes have a high specific heat capacity
Explanation: ape x
What is the name of muscle's state of perpetual partial tension?
Muscle tone, or tonus, is the state of perpetual partial tension in muscles. It allows muscles to maintain posture and readiness for action, while muscle tension can vary to handle different levels of load.
The name of the muscle's state of perpetual partial tension is muscle tone or tonus. This state helps to maintain posture and ensures that muscles are ready for action. The control of muscle tension involves neural control that initiates the formation of actin-myosin cross-bridges. The tension a muscle produces can vary, allowing it to handle different levels of load, from light objects to heavy objects. During an isotonic contraction, tension in the muscle remains constant as the muscle changes length. Factors like the cross-sectional area of the muscle fiber and the frequency of neural stimulation influence the amount of tension produced.
The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?
There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.
What are restriction enzymes?A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.
Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.
Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.
Learn more about restriction enzymes:
https://brainly.com/question/14953274
#SPJ6
Identify the medical term referring to a (head) cold:
The medical term referring to a head cold is coryza. The coryza occurs when an individual’s mucous membranes in their nasal cavity has a presence of inflammation in which will likely result into having a hay fever or causing a person to have a cold.
The medical term referring to a (head) cold is rhinorrhea, which is the excessive production of mucus in response to a viral infection. It is a common symptom of a cold and is often accompanied by sneezing, congestion, sore throat, and coughing.
Explanation:The medical term referring to a (head) cold is rhinorrhea. Rhinorrhea is the medical term for a runny nose, which is a common symptom of a cold. It occurs when the nasal tissues produce excessive mucus in response to a viral infection. Other symptoms of a cold may include sneezing, congestion, sore throat, and coughing.
Learn more about Rhinorrhea here:https://brainly.com/question/34319474
#SPJ6
Human growth hormone is a secreted protein that stimulates growth and cell reproduction. in the 1960s it was discovered that this was an effective treatment for a form of dwarfism. however, before it was genetically engineered, it was _____
The answer is that it was harvested from cadavers which are corpses of a body that is deceased—they are used before the treatment that is effective for dwarfism was genetically engineered and by this, there has been some studies and researches that has been found out when they harvested from the cadavers.