Let x have a poisson distribution with a variance of 3. find p(x = 2).

Answers

Answer 1
Since the variance of a Poisson distribution with rate parameter [tex]\lambda[/tex] is [tex]\lambda^2[/tex], we know that [tex]\lambda=\sqrt3[/tex]. So,

[tex]\mathbb P(X=2)=\dfrac{e^{-\sqrt3}(\sqrt3)^2}{2!}=\dfrac3{2e^{\sqrt3}}\approx0.2654[/tex]
Answer 2
Final answer:

The probability that a Poisson random variable X equals 2, given that its variance is 3, is approximately 0.2240.

Explanation:

The student asks about finding the probability that a Poisson random variable X takes on a value exactly equal to 2, given that the variance of X is 3. We know for a Poisson distribution, the variance is equal to its mean, which is denoted by λ (lambda). Therefore, λ = 3.

Using the formula for the Poisson probability mass function (PMF), P(X = k) = (e^(-λ) * λ^k) / k!, we can calculate P(X = 2). Substituting λ = 3 and k = 2, we have:

P(X = 2) = (e^(-3) * 3^2) / 2! = (0.0497871 * 9) / 2 = 0.224041.

We can round this probability to four decimal places:

P(X = 2) ≈ 0.2240.


Related Questions

simplify the expression 4y - 1 - 3y + 2

Answers

okay, so basically all you need to do is combine like terms!
in this case, 4y and -3y are like terms... and -1 and 2 are like terms
so, 4y - 3y is 1y or y
and -1 + 2 is 1

so your simplified answer is y + 1

I hope this helps!!

find the gradient of the line between each pair of points A(2,2) and B(6,6)

Answers

In other words, find the slope of the line connecting the points (2,2) and (6,6).
                                 6-2
This slope is m = ------------ = 1 
                                6-2

At State College, the cost of tuition is $6168, housing is $3280, the meal plan is $2190, and books cost $1200. How much would you need to pay to attend State College for 4 years given your family will contribute $17,600?

Answers

Let's calculate the total cost per year:
6168 + 3280 + 2190 + 1200 = 12,838.
Four years will cost 12838 x 4 = 51,352
Your family will help you out with 17,600, so you will need to pay:
51352 - 17600 = 33,752

graph the linear equation. Find 3 points to solve the equations. -5x+2y=11

Answers

Sent a picture of the solution to the problem (s).

Can I get some points? Please ask me a very simple question like 1 plus 1 or sum and I will answer and get pts? please? Youll get 10 points lol if you have a lot can I get like 70 or sum

Answers

ok then what 1.11111111. 2.2222222

Answer:the answer is two double check i could be wrong


Step-by-step explanation:1 x 1 x 1 + 1 / 1 = 2



A person invests $4000 at 2% interest compounded annually for 4 years and then invests the balance (the $4000 plus the interest earned) in an account at 8% interest for 7 years. Find the value of the investment after 11 years.

(Hint: You need to break this up into two steps/calculations. Be sure to round your balance at the end of the first 4 years to the nearest penny so you can use it in the second set of calculations.)

Answers

[tex]\bf \qquad \textit{Compound Interest Earned Amount} \\\\ A=P\left(1+\frac{r}{n}\right)^{nt} \quad \begin{cases} A=\textit{accumulated amount}\\ P=\textit{original amount deposited}\to &\$4000\\ r=rate\to 2\%\to \frac{2}{100}\to &0.02\\ n= \begin{array}{llll} \textit{times it compounds per year}\\ \textit{annually, thus once} \end{array}\to &1\\ t=years\to &4 \end{cases} \\\\\\ A=4000\left(1+\frac{0.02}{1}\right)^{1\cdot 4}\implies A=4000(1.02)^4\implies A\approx 4329.73[/tex]

then she turns around and grabs those 4329.73 and put them in an account getting 8% APR I assume, so is annual compounding, for 7 years.

[tex]\bf \qquad \textit{Compound Interest Earned Amount} \\\\ A=P\left(1+\frac{r}{n}\right)^{nt} \quad \begin{cases} A=\textit{accumulated amount}\\ P=\textit{original amount deposited}\to &\$4329.73\\ r=rate\to 8\%\to \frac{8}{100}\to &0.08\\ n= \begin{array}{llll} \textit{times it compounds per year}\\ \textit{annually, thus once} \end{array}\to &1\\ t=years\to &7 \end{cases} \\\\\\ A=4329.73\left(1+\frac{0.08}{1}\right)^{1\cdot 7}\implies A=4329.73(1.08)^7\\\\\\ A\approx 7420.396[/tex]

add both amounts, and that's her investment for the 11 years.

Jade spend $37.60 on groceries. 4/5 of that total was spent on vegetables. How much was spent on other items

Answers

$7.52 was spent on the other items

divide the total spent by 5 to get what 1/5 is

37.60 / 5 = 7.52

 they spent $7.52 on other items

99 POINTS TOP RECORD I NEED PRO'S FOR THIS!


HELP ASAP


!! ;D

Answers

(-10.3)(2)x = 4(-10.3)(2)

cross out the same terms on both sides and you end up with x =4

(-10.3)2x = 4(-10.3)(2)

2x(-10.3) = -82.4

Divide both sides by -10.3
2x = -8
Get x by itself
x = -4
 
Hope this Helps!

Quadratic word problem:

A number minus 8 times its reciprocal equals 2. What is the number? (There may be more than one answer)

Answers

Final answer:

To solve the quadratic word problem, we set up the equation x - 8/x = 2 and simplify it to x^2 - 2x - 8 = 0. Using the quadratic formula, we find two possible values for x: -2 and 4.

Explanation:

To solve this quadratic word problem, we set up the equation: x - 8/x = 2. To simplify the equation, we multiply both sides by x to eliminate the denominator: x^2 - 8 = 2x. Rearranging the equation, we get x^2 - 2x - 8 = 0. To find the solutions, we can use the quadratic formula: x = (-b ± √(b^2 - 4ac)) / (2a). Substituting the values from our equation, we have x = (2 ± √(2^2 - 4(1)(-8))) / (2(1)). Solving the equation, we find two possible values for x: x = -2 or x = 4.

Matty jogs 9 km/hr. Identify the correct conversion factor setup required to compute Matty's speed in m/s.

Answers

=9 * 1000 / 3600
=9000 / 3600
=2.5m/s

I hope this helps you

Answer:

2.5 m/s

Step-by-step explanation:

we have given that Matty jogs 9 km/hr

we have to convert 9 km/hr to m/s

we know, 1 km= 1000 m

and 1 hr= 60 minutes and  1 minute= 60 seconds

which implies that 1 hr=60 x 60 = 3600 seconds

now, to convert km/hr into minute/second we have to multiply it by  1000/3600  or 5/18

i.e. 9×1000/3600= 5/2=2.5 m/s


What is the unit rate for 822.6 km in 18 h? Enter your answer, as a decimal, in the box. ______.

Answers

You do 822.6 divided by 18
It is equal to 45.7
45.7 km per hour

we know that

A unit rate is a ratio between two different units with a denominator of one

In this problem to find the unit rate divide the total distance by the total time

so

[tex]\frac{822.6}{18} \frac{Km}{hours}= 45.7\frac{Km}{hour}[/tex]

therefore

the answer is

The unit rate is equal to [tex] 45.7\frac{Km}{hour}[/tex]

Graph the following sequence of transformations for

Answers

[tex]\bf \qquad \qquad \qquad \qquad \textit{function transformations} \\ \quad \\\\ % left side templates \begin{array}{llll} f(x)=&{{ A}}({{ B}}x+{{ C}})+{{ D}} \\ \quad \\ y=&{{ A}}({{ B}}x+{{ C}})+{{ D}} \\ \quad \\ f(x)=&{{ A}}\sqrt{{{ B}}x+{{ C}}}+{{ D}} \\ \quad \\ f(x)=&{{ A}}(\mathbb{R})^{{{ B}}x+{{ C}}}+{{ D}} \\ \quad \\ f(x)=&{{ A}} sin\left({{ B }}x+{{ C}} \right)+{{ D}} \end{array}\\\\ --------------------[/tex]

[tex]\bf \bullet \textit{ stretches or shrinks horizontally by } {{ A}}\cdot {{ B}}\\\\ \bullet \textit{ flips it upside-down if }{{ A}}\textit{ is negative}\\ \left. \qquad \right. \textit{reflection over the x-axis} \\\\ \bullet \textit{ flips it sideways if }{{ B}}\textit{ is negative}\\ \left. \qquad \right. \textit{reflection over the y-axis}[/tex]

[tex]\bf \bullet \textit{ horizontal shift by }\frac{{{ C}}}{{{ B}}}\\ \left. \qquad \right. if\ \frac{{{ C}}}{{{ B}}}\textit{ is negative, to the right}\\\\ \left. \qquad \right. if\ \frac{{{ C}}}{{{ B}}}\textit{ is positive, to the left}\\\\ \bullet \textit{ vertical shift by }{{ D}}\\ \left. \qquad \right. if\ {{ D}}\textit{ is negative, downwards}\\\\ \left. \qquad \right. if\ {{ D}}\textit{ is positive, upwards}\\\\ \bullet \textit{ period of }\frac{2\pi }{{{ B}}}[/tex]

with that template in mind.

[tex]\bf f(x)=\sqrt[3]{x}\qquad \boxed{-f(x+2)+4}\implies f(x)=\stackrel{A}{-1}\sqrt[3]{\stackrel{B}{1}x\stackrel{C}{+2}}\stackrel{D}{+4}\qquad \\\\\\ f(x)=-\sqrt[3]{x+2}+4[/tex]

A  = -1, reflected over the x-axis

B = 1, C = 2,  horizontal shift of C/B or 2, to the left.

D = 4, shifted upwards by 4 units.

check the picture below.

Ann had 75 fliers to post around town. Last week,
she posted 2/5 of them. This week, she posted 2/3 of the remaining fliers. How many fliers has she still not posted?

Answers

so, she had 75 fliers total, then she posted 2/5, how much is 2/5 of 75?  well, is just their product,

[tex]\bf 75\cdot \cfrac{2}{5}\implies \cfrac{150}{5}\implies 30 \\\\\\ \textit{how much is }\frac{2}{3}\textit{ of }\stackrel{remaining~75-30}{45}\textit{ fliers?}\qquad 45\cdot \cfrac{2}{3}\implies \cfrac{90}{3}\implies 30[/tex]

so, she had 75 total, she posted 30, then 30 again, so she hasn't posted 75 - 30 - 30.

jose rodriguez's checking account had a starting balance of 1,234.56. he wrote a check for 115.12 for plumbing supplies and check for 225.00 for a loan payment. Yesterday he deposited 96.75 in his checking account. what jose's current balance?

Answers

Jose's current balance is 991.12
Hopes this helps.


five quarts of latex enamel paint will cover about 100 square feet of wall surface. how many quart are needed to cover 71 square feet of kitchen wall and 69 square feet of bathroom wall ?

Answers

71 + 69 = 140.....so there is 140 sq ft to cover

100 / 5 = 140 / x....100 sq ft to 5 qts = 140 sq ft to x qts
cross multiply
(100)(x) = (140)(5)
100x = 700
x = 700/100
x = 7 qts <==== 7 qts will be needed

Every year, a teacher surveys his students about the number of hours a week they watch television. In 2002, his students watched an average of 12 hours of television per week. In 2012, the number of hours spent watching television decreased to five per week. What is the percent decrease in the hours of television watched, rounded to the nearest tenth? 5.8% 4.2% 41.7% 58.3%

Answers

Answer:

58.3%  

Step-by-step explanation:

The percent decreased in the hours of television watched is 58.3%.

What is percentage?

A percentage is a number or ratio that can be expressed as a fraction of 100. Also called per centum. one one-hundredth part; 1/100. percentage.

Given that, in 2002, the students watched an average of 12 hours of television per week. In 2012, the number of hours spent watching television decreased to 5 hours per week

We need to find the percent decrease in the hours of television watched,

Percent decreased = Difference in the initial and final quantity / initial quantity × 100

Percent decreased = 12-5 / 12 × 100 = 7/12 × 100

= 58.3%

Hence, the percent decreased in the hours of television watched is 58.3%

Learn more about percentage, click;

https://brainly.com/question/29306119

#SPJ6

From 1980 to 1990, Lior’s weight increased by 25%. If his weight was k kilograms in 1990, what was it in 1980?

Answers

An increase of 25% is represented by the multiplier 1.00 + 0.25, or 1.25.
Then Lior's 1980 weight, mult. by 1.25, results in his 1990 weight, or k kg.

Let his 1980 weight be w.  Then 1.25w = k.  Divide both sides by 1.25 to obtain w, Lior's 1980 weight:

1.25 w = k
---------    ------- = (4/5)k, or 4k/5 (answer)
  1.25      1.25

Ththe weight of Lior in 1990 in terms of k is [tex]\frac{4}{5} k[/tex]

Let the weight of Lior in 1980 be "w"

If Lior's weight increased by 25%, his new weight was "k". This can be expressed as:

w + (25% of w) = k

w + (0.255w) = k

w + 0.15w = k

1.25w = k

Divide both sides by 1.25

[tex]\frac{1.25w}{1.25} =\frac{k}{1.25} \\w=\frac{k}{1.25} \\w=\frac{100k}{125} \\w=\frac{4}{5}k[/tex]

This shows that the weight of Lior in 1990 in terms of k is [tex]\frac{4}{5} k[/tex]

Learn more here: https://brainly.com/question/7287613

is the square root of 10 greater than,less than or equal to 5

Answers

It is less than five.

Another order calls for 26 widgets. The widgets comes in boxes of 5. How many full boxes of 5 do you pull? How many single items do you still need?

Answers

divide 26 by 5

26 /5 = 5.2

 so 5 full boxes

5*5 = 25

26-25 = 1

 so 5 full boxes and 1 single widget

Final answer:

For an order of 26 widgets with each box containing 5 widgets, you would pull 5 full boxes and still need 1 more single widget.

Explanation:

To solve this problem, we need to find out how many full boxes of 5 widgets we can make from 26 widgets and how many single widgets we will have left. Whole number quantities, such as the number of widgets and boxes, are important here. First, we divide 26 by 5 to find out the number of full boxes. This gives us 5 full boxes with a remainder of 1, which means we have one widget left. So, we pull 5 full boxes and still need 1 more single widget.

Learn more about Dividing Whole Numbers here:

https://brainly.com/question/10221961

#SPJ12

5x - 3(1 + 2x) =24 - 4x

Answers

5x - 3(1 + 2x) = 24 - 4x

5x -3 - 6x = 24 - 4x

-x - 3 = 24 - 4x

3x = 27

3x/3 = 27/3

x = 9

hope this helps

Is it linear or not, the height of a person and the persons age?

Answers

it is not linear because growth height varies with age
It's not because growth rates vary with age, gender also plays a role in the change

During a certain week, a post office sold Rs.280 worth of 14-paisas stamps. How many of these stamps did they sell?

Answers

So basically ...

You convert the rupees in paisas. One rupee is equal to one hundred paisas, so ...

280 × 100 = 28,000

And then we divide,

28,000 ÷ 14 = 2000

The post office sold 2000 stamps!

Hope this helped! :)

The post office sold 2000.

To find out how many 14-paisa stamps the post office sold to make Rs.280, we need to follow a step-by-step solution.

Convert the total amount from rupees to paisas:Since the stamp's value is given in paisas.There are 100 paisas in 1 rupee.Rs.280 = 280 x 100 = 28000 paisas.The value of one stamp is 14 paisas.To find the number of stamps sold, we divide the total amount in paisas by the value of one stamp:

28000 paisas ÷ 14 paisas per stamp = 2000 stamps.

What is the prime factorization of 72?

Answers

Ik that 9 is one of em
Hope this helps have a nice nite
Hello!

72 is not a prime number, but your answer would be:
[tex] {2}^{3} \times {3}^{2} [/tex]

I really hope my answer benefites you! c:

Lilia parked her 18 model cars in equal rows. 3time6. Write another way lilia could arrange her cars in equal rows

Answers

she could do 2 rows with 9 cars. 2x9
Divide 18 by 2 and you get 9. Therefore you can arrange them by 9x2=18

which of the following is not a example of a molecule

A H2s
B Mn
C KOH
D O3

Answers

The correct answer is D.
molecules refer to the smallest particle in a compound or an element, which possesses the chemical properties of that compound or element. They  are also made up of atoms which are held together by chemical bonds as result of exchange or sharing of electrons.
The Formula given in option D is an atom not a molecule because it is not sharing any bond with any other atom.
O3 is the correct answer :)!!

A farmer harvested 35 acres of corn and 20 acres of beans. Animals ate 1/8 of the corn he originally planted. how many acres of corn did the farmer plant?

Answers

now..... we're assuming here, that the farmer planted "more than 35 acres" of corn, so, he planted some amount of corn, but he only harvested a fraction of it, which is 35 acres, and we're assuming he gave those 35 acres of harvested corn to the livestock, so the animals ate 1/8 of the corn he planted.

That means, if the animals ate 1/8 of the corn, and the farmer gave the animals the whole of the harvested corn, then we can say that the 35 acres is just 1/8 of what he planted.

now, if 35 is 1/8, what is the whole?  namely 8/8?

[tex]\bf \begin{array}{ccll} \stackrel{corn}{amount}&\stackrel{corn}{fraction}\\ \text{\textemdash\textemdash\textemdash}&\text{\textemdash\textemdash\textemdash}\\ 35&\frac{1}{8}\\\\ c&\frac{8}{8} \end{array}\implies \cfrac{35}{c}=\cfrac{\quad \frac{1}{8}\quad }{\frac{8}{8}}\implies \cfrac{35}{c}=\cfrac{1}{8}\cdot \cfrac{8}{8} \\\\\\ \cfrac{35}{c}=\cfrac{1}{8}\implies 280=c[/tex]

A really bad carton of 18 eggs contains 9 spoiled eggs. an unsuspecting chef picks 6 eggs at random for his "mega-omelet surprise." find the probability that the number of unspoiled eggs among the 6 selected is

Answers

Final answer:

To find the probability that the number of unspoiled eggs among the 6 selected is X, we can use the hypergeometric probability formula. This formula is used when the sample drawn is without replacement from a finite population.

Explanation:

To find the probability that the number of unspoiled eggs among the 6 selected is X, we can use the hypergeometric probability formula. This formula is used when the sample drawn is without replacement from a finite population. In this case, we have 18 total eggs in the carton, with 9 spoiled eggs. So the probability that X unspoiled eggs are selected out of the 6 can be calculated as:

P(X) = (C(X,6) * C(9,6)) / C(18,6)

Where C(n,r) represents the combination of n things taken r at a time.

While going on a field trip, a busload of 54 students will have to be split up into three groups. two thirds will go to lunch first, and one third will go visit the exhibits. how many will go to lunch first?

Answers

*Given
Total number of students                                 - 54
Fraction of students going to lunch first           - 2/3
Fraction of students going to the exhibit first   - 1/3

*Solution
1. Since the students are grouped into 3, the total number of students must be divided into 3 to determine the number of students in each of the 3 groups.

                             54/3 = 18

Thus, there are 18 students per group. 

2. Two-thirds (2/3) of the total number of students will go to lunch first. Since the total number of students have already been divided into 3 groups, this simply means that 2 of the 3 groups will go to lunch first. Since each group has 18 students, 2 groups would have, 

                              18*2 = 36

Thus, 36 students will go to lunch first. 



Calculate the second moment of area of a 4-in-diameter shaft about the x-x and yy axes, as shown.

Answers

Final answer:

To calculate the second moment of area for a 4-inch diameter shaft about the x-x and yy axes, we use the formula I = π * d^4 / 64 and find that I = 4 * π in´ for both axes.

Explanation:

The student is asking for the calculation of the second moment of area, also known as the moment of inertia, for a shaft with a 4-inch diameter about both the x-x and yy axes.

The moment of inertia of a circular cross-section about its centroidal axis is calculated using the formula I = π * d^4 / 64, where d is the diameter of the shaft. In this case, the diameter d is given as 4 inches.

To calculate the second moment of area for the 4-inch diameter shaft, we substitute the diameter into the formula to get:


I = π * (4 in)^4 / 64 = π * 256 in´ / 64 = 4 * π in´.


So, the moment of inertia for both the x-x and yy axes would be the same and equal to 4 * π in´, since the shaft is symmetrical about these axes.

-5/11h=-5/9
Show your work please

Answers

-5/11h = -5/9..divide both sides by -5/11
h = (-5/9) / (-5/11)...when dividing with fractions, flip what u r dividing by, then multiply

h = -5/9 * - 11/5
h = 11/9 or 1 2/9 <=
Other Questions
James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Steam Workshop Downloader