The first president to raise cultivation of the media to an art form was

Answers

Answer 1
The first president to raise cultivation of the media to an art form was Theodore Roosevelt.

Related Questions

What did the inca emperors forced conquered peoples to do in order to unify their empire?

Answers

To use Quechua, the Incan language

Because Canada is a parliamentary democracy, its political leader
A) is whoever is the eldest child of the current reigning monarch.
B) is elected by the majority of the popular votes of its citizens.
C) is chosen by the party with the majority of members in legislature.
D) is elected by an electoral college chosen by the unicameral legislature.

Answers

I had the same question and cant seem to find the answer either
I believe the answer is C. From my limited knowledge on Canadian politics, I think it goes like this:

People elect representatives for parliament --> Group/party with the most members elected into parliament gets to choose the Prime Minister OR the parliament votes on who they want to lead and the winner becomes the Prime Minister.

John Adams’ Alien and Sedition Acts influenced the election of 1800 because

Answers

they were widely unpopular because people saw them as the federal government becoming too powerful. Power transferred to the Democratic-Republicans under Jefferson’s election, with the states holding more power. John adams believe that giving government too much power will imprison the true liberty of the people and make us had to live with constant risk of the government transforming into tyranny without anything we can do to stop them.

John Adams’ Alien and Sedition Acts influenced the election of 1800 because the Naturalization Act was denounced and that caused the Democratic-Republicans to win the 1880 election.The Federalist were greatly opposed by the Democratic-Republicans during the French Revolution. The Democratic-Republicans opposed the implementation of rules of the Federalist.

When the majority of people are united by a common ethnicity, language, and culture, this is known as a(n) ____________.

Answers

When the majority of people are united by a common ethnicity, language, and culture, this is known as a nation.
A nation is a large group of people who are connected through these common characteristics they all share. Even though they may not be living in the same country, they are still originally part of the same nation. Thus nation-state, embassy, and country are incorrect answers.

Answer:

it's A! .... ( I Think )

Explanation:

Which of these would be the BEST way to influence your town's mayor?

Answers

Make a blog about your town's mayor is a good idea, or go up to him and tell him stuff.
You can make a blog of the town like the first comment says or you could make a video of how your town has changed over the years

You will read and review the provided primary source documents. You then will analyze the documents using the following criteria:

1. Brief summary
2. Author's Purpose
3. Historical Context

Answers

1. The Cherokee have decided that they have the right to remain where they live without 'interruption or mole-station'. They point out to the law and treaties made with the US that allowed them to live in the area and defend themselves against the intruders. They "only request" that they be able to continue living in the area. They plead to stay, because if they move "ruin [is] before us", & that the "country west... is unknown to [them]". It also has large amounts of Indian tribes which will regard them as "intruders", because they have different languages, beliefs, & cultures. They would eventually have war with them because of these differences, which the Cherokee's do not want, & so they plead to stay in their area.

2. To plead to stay in their area

3.The US wanted to move all Indian tribes to reservations to allow settlers to take their lands

hope this helps

What body of the legislature hold the trial of the president is impeached?

Answers

The senate holds the impeachment trails. 

Answer:

The Senate

Explanation:

The Constitution gives the House of Representatives the sole power to impeach an official, and it makes the Senate the sole court for impeachment trials. The power of impeachment is limited to removal from office but also provides for a removed officer to be disqualified from holding future office.

. Can you think of military reasons for the severe treatment of Tyrian survivors‘?

Answers

Prior to Tyre, no other enemy ever resisted Alexander's advances. During the siege on Tyre, Alexander lost many men and it cost him a lot of money. By torturing the Tyrian survivors, he let other potential enemies know that surrender was always better than resistance.
Final answer:

The harsh treatment of Tyrian survivors was a strategic military tactic known as 'calculated frightfulness', used to discourage future rebellions by instilling fear through severe punishment and gross brutality.

Explanation:

The severe treatment of Tyrian survivors can be attributed to a concept known as 'calculated frightfulness', employed by coercive states in history, such as the Neo-Assyrians. This strategy was used to quell any potential rebellions among conquered peoples, by inflicting severe punishments on those who resisted.

Examples could include public torture and mutilation, or the forced enslavement of survivors. Such acts were intended to 'demonstrate' the dire consequences of rebellion, to not only the conquered Tyrians, but also to other potential adversaries.

A similar tactic was witnessed during the U.S. war in Vietnam, where the military often burned villages suspected of harboring Viet Cong fighters, to both deprive the enemy of potential support and to retaliate for the enemy's brutality.

Learn more about Calculated frightfulness here:

https://brainly.com/question/32253353

#SPJ11

Members of Dadaist artistic movement believed that world war 1 had been caused by

Answers

The members of Dadaist Artistic movement felt that the logic and reason behind capitalist society led to WWI. This belief they felt had led to irrationality and chaos in the society which eventually led to the war. 
the emphasis on logic and rationality in industrial society.

Following Jay’s Treaty, George Washington’s approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some?

Answers

The Pro-French believed that it didn't protect American sailors from being captured and seized by the British. They were worried that they were leaning more towards the British side and becoming more anti-french.

Even though both sides of the bargain achieved something, the treaty became a point of controversy because it could be viewed as an agreement that favored the british, being that a lot of issues caused by them, such as wartime damages, illegal capture of american ships and conflicts with the indians caused by the british occupation. The british agreed with leaving said posts but only after one year and a half. In the treaty there was also a ton limit to the trade that americans could have, making profiting from the pelt trade almost impossible.

Also, the treaty was configured in a way that seemed to favor the Federalists to the detriment of the opposing party, the Jeffersonians (who where against the british, believing that Britain opposed the values of the American people, prefering to support France whenever international issues called for U.S. contribution), who rallied against Washington, Hamilton and Jay. The Federalists where in favor of the british, believing that going against the british in this matter could lead to war against them.

How did napoleon gain popularity in france?

Answers

They need a strong leader.

Why did the united states get involved in the korean war? what was the outcome of the war?

Answers

On June 25, 1950, the Korean War began when North Korea, supported by the Soviet Union and China, invaded South Korea, which was supported by the United States. General MacArthur, leader of theUnited Nations forces, drove the North Koreans back across the divide, yet encountered a Chinese invasion.

They asked the U.S. for help

which of the following events led to the ethnic conflict in the Balkans in 1989

Answers

Yugoslavian republics declared independence after Serbia attempted to dominate minority groups

Answer:

The impact of the ethnic conflict in the Balkans especially of race beliefs and some other things resulted in 100,000 people killed and 1 million people relocated from their homes during this conflict. Refugees fled to neighboring European countries and the European Union, and NATO sent peacekeeping troops to the region to prevent the conflict from starting again.

Explanation:

When did the industrial revolution start in america?

Answers

An early landmark moment in the Industrial Revolution came near the end of the eighteenth century, when Samuel Slater brought new manufacturing technologies from Britain to the United States and founded the first U.S. cotton mill in Beverly, Massachusetts.

Final answer:

The Industrial Revolution in America started in the late 18th century, expanding from New England textile manufacturing to steel and automobile production and transforming the economy from agriculture to industry.

Explanation:

The Industrial Revolution in the United States began in the late 18th century after starting in Great Britain. It brought a profound shift in the American economy, signaling a move from manual labor to mechanized manufacturing. Focused initially on textile production in New England, the revolution quickly expanded into steel and metal manufacturing in Pennsylvania and Indiana, and later into automobile manufacturing in Michigan. Essential to this growth was the availability of power sources, such as coal, which fueled industries in Pennsylvania and Appalachia.

This period of rapid industrial development and urbanization marked fundamental changes in the American way of life. As the use of power-driven machinery became more widespread in the first half of the 1800s, tasks that previously required extensive human labor, like those done by the steam engine and power loom, were revolutionized. The economic and social landscape of the United States was dramatically transformed as a result, with increasing numbers of individuals leaving agricultural work to pursue industrial jobs in burgeoning urban areas.

"which chinese dynasty replaced the mongol yuan dynasty in 1368?"

Answers

The Ming dynasty replaced the Mongol Yuan dynasty in 1368.

Explain the factors that led to the japanese miracle

Answers

economically trusting eachother.

Why did the europeans decide to explore the americas?

Answers

To Gain Control for american resorces

who was the first head of the american nation under the articles of confederation

Answers

The Articles of Confederation, the precursor to the United States Constitution, did not provide for a single head of government. The only national governing body was Congress, which developed laws but couldn't enforce them. Almost all powers were delegated to the individual states.

John Hanson was the first head of the American nation under the Articles of Confederation, serving as the ceremonial President of the United States in Congress Assembled from 1781 to 1782.

Hanson, a respected merchant and public official from Maryland, took on the role of "President of the United States in Congress Assembled." He served from November 5, 1781 to November 3, 1782. While the position he held was mostly ceremonial, without the executive powers we associate with the presidency today, Hanson's contributions included issuing the first Thanksgiving proclamation. Hanson's term lasted one year, and he was succeeded by seven other men who also served one-year terms each.

The Articles of Confederation, drafted in 1777 and ratified in 1781, were the United States' first constitution and formed the nation's first central government. They created an alliance of sovereign states with a weak central government that had no powers without the consent of the states. Despite the limitations, the Articles of Confederation were a remarkable step towards unifying the country under a national government.

An interest group that gives money collected from members to political candidates or parties is called a ________________ __________________ ______________________.

Answers

Not positive but I think the answer is "Lobbyists" .

How do you think the increase in traffic affected the economic development of the cities along this route

Answers

Providing people with more choices in housing, shopping, communities, and transportation is a key aim of smart growth. Communities are increasingly seeking

Why is the battle of waterloo so important?

Answers

The Battle of Waterloo was fought near the town of Waterloo, Belgium (then the Netherlands). Napoleon led his battered French Army (73,000 men) against the combined might if the British Army led by the Duke of Wellington and a Prussian Army led by General von Blücher (118,000 men combined/ 31,000 Brits, 50,000 Prussians, 17,000 Dutch, 20,000 Hannover/Nassau/Brunswick men). The Brits and Germans were going to be reinforced by Russian and Austrian troops soon bringing the entire Seventh Coalition to bear against Napoleon's force. Napoleon hoped to go on the offensive, smashing the British and Germans, and destroy the Russians and Austrians piecemeal. Thing is, he almost beat the Coalition at Waterloo too.

Before the battle the Prussians were beaten at Lingy and Wellington was fought to a stalemate at Quatre Bras; however, with the Prussians pulling back Wellington was forced to do the same. Napoleon sent a part of his force to chase off the Prussians while his main force crushed Wellington, now camped around Waterloo. However, the Prussian rearguard tied down their French pursuers at Wavre. This allowed the rest of the Prussian Army to move to reinforce Wellington. Wellington meanwhile was having an increasingly hard time beating back the French attacking his men at the Mont-Saint-Jean escarpment. However the increasing number of arriving Prussians eventually put an end to French assaults, which were followed by Allied attacks. The Prussians quickly broke the French right and the rest of the French army soon followed suit. Napoleon retreated leaving 26,000 men dead on the field with an additional 15000 wounded. The Allies had it a lot better, losing only about 24000 or so if I remember correctly.

The loss was a tremendous blow, ending any remote hope of Napoleon fending off the Seventh Coalition. With British and Prussian forces consolidated and Russian and Austrian reinforcements on the way the writing was on the wall, Napoleon abdicated 4 days later on June 22nd, 1815. The Seventh Coalition took Paris on July 7th and the French Empire was brought to an end. Napoleon would die some years later in exile on the tiny island of St Helena. Meanwhile, Europe entered a period of relative peace, until the German Wars of Unification.

How do you think chicago, new york, and other northern cities changed as a result of the arrival of so many african americans? write two or three examples of things that might change in these cities thanks to new migration?

Answers

There was new music, such as jazz and the blues. New churches and religious customs came north. There was different food and spoken dialect. Celebrations from their cultures came along with new neighborhoods. Finally, newspapers and journals had more of an impact.

In the 1840s, fugitive slaves and freedmen founded the city's first black settlement. Between 1910 and 1960, the Great Migrations transported hundreds and thousands of blacks from the South to Chicago, where they established themselves as an urban community.

New music, such as jazz and blues, was available. New religious rituals and churches were established in the north. Food was distinct, as was the spoken language. New neighborhoods brought new celebrations from their cultures. Finally, newspapers and journals began to have a greater influence.  

For more information regarding the African Americans arrival in Chicago, refer to the link:

https://brainly.com/question/23766275

Why were akbars tax policies so successful

Answers

Because they had more power and control

Akbar's tax policies were successful because they promoted fairness, religious tolerance, and efficient governance. By creating a loyal bureaucratic system and ensuring no discriminatory taxes, he was able to harness the potential of all subjects and maintain stability within the empire.

Akbar's tax policies contributed significantly to the success and stability of the Mughal Empire. These policies were designed to be fair and efficient, ensuring the stability and loyalty within his domain. By eliminating discriminatory taxes such as the jizya, which was a tax on non-Muslims, Akbar promoted religious toleration, which allowed him to harness the energies and abilities of all his subjects, regardless of their faith. His interest in learning about different religions and inviting discussions on theology created a more inclusive environment.

Akbar revolutionized the bureaucratic system by dividing the empire into provinces and appointing civil servants known as mansabdars, who were compensated through the taxes collected. Promotion among these mansabdars depended on their performance and loyalty to Akbar. Furthermore, Akbar ordered that the empire be surveyed and fields assessed to determine revenue potential, which resulted in more accurate and fair taxation.

Among the mansabdars, land was assigned based on rank and periodically reassigned, with wealth reverting to Akbar upon a mansabdar's death. This system ensured loyalty to the emperor while preventing the accumulation of power that could challenge his rule. The success of Akbar's tax policies also allowed for a unified and peaceful subcontinent and supported cultural and charitable endeavors, which further solidified his rule and the prosperity of his empire.

The bill of rights is an important addition to the constitution because it?

Answers

Hi Ariana, thanks for asking a question here on Brainly.

The Bill of Rights is an important addition to the constitution because it guarantees a person's basic rights. 

Answer: Letter A ✅

Hope that helps! ★ If you have further questions about this question or need more help, feel free to comment below or post another question and send the link to me. -UnicornFudge aka Nadia 

Final answer:

The Bill of Rights was added to the Constitution primarily because certain key states refused to ratify it without these specific protections for individual liberties. These first ten amendments limit the power of the government and protect rights such as free speech, religion, and fair legal proceedings. The Fourteenth Amendment and judicial interpretation have expanded these rights to apply at the state level as well.

Explanation:

The Bill of Rights is an essential addition to the Constitution because it serves as a safeguard for the individual liberties and freedoms that define American democracy. It was added primarily because key states would not ratify the Constitution without the inclusion of these protections. This set of amendments limits the power of the government and provides a range of rights, including freedom of speech, religion, press, assembly, the right to bear arms, and protections during legal proceedings. The Bill of Rights was introduced by James Madison in 1789 and formally adopted in 1791 after the Constitution was ratified.

Over time, these first ten amendments have become a core part of American values, symbolizing what Americans cherish in their political and social systems. Additionally, the Fourteenth Amendment and various Supreme Court decisions have extended these protections at the state level through a process known as selective incorporation. The balance of individual rights against society's interests continues to be a significant topic of debate in American jurisprudence.

How did constantinople respond to numerous invasion attempts before 1453?
a. it fought them off but was weakened.
b. it fought them off and became stronger.
c. it fell to the armies of ottoman turks.
d. it fell to the armies of arab muslims.

Answers

Answer:

The correct answer is A. "It fought them off but was weakened."

Explanation:

Answer: A

Explanation: Fought them off but was weakened (they fell to the ottoman turks in 1453, but the questions states what happened BEFORE 1453)

How did imperialism justify colonization of hawaii, philippines, and the caribbean?

Answers

Any answers I could choose from?

Which of the following accurately summarizes an idea of French Enlightenment philosopher Jean-Jacques Rousseau? (5 points)
A) Human beings are naturally innocent and good, but society corrupts them.

B) Human beings are naturally selfish and need a strong government to control them.

C) Economic markets will regulate themselves without government interference.

D) Economic markets need government regulation in order to function properly.

Answers

As far as I remember the only statement which accurately summarizes the idea of French Enlightenment philosopher Jean-Jacques Rousseau is A) Human beings are naturally innocent and good, but society corrupts them. Society tried to make people selfish and don't care about others

Answer:

Human beings are naturally innocent and good, but society corrupts them.

Explanation:

Hope this helps :)

HI PLEASE HELP ME WITH ONE HISTORY QUESTION!!!! 39 points + brainiest!!!!!
You have to match a number with the CORRECT letter.

1. belief that everything is God
2.one who is outside the caste system
3.Chinese philosopher
4.200 years of peace
5.protection against invaders
6.first Chinese dynasty Pax Sinica
7.mountains isolating India

a. Confucius
b. Shang
c. untouchable
d.Himalayas
e.pantheism
f.Pax Sinica
g. Great Wall

Answers

E. Pantheism 1.
C. Untouchable 2.
F. Pax Sinica 4.
G. Great Wall 5.
D. Himalayas 7.
A. Confucius 3.
B. Shang 2.

Based on the paragraph above, what form of government did ancient Greece and ancient Mesopotamia have in common? A Patriarchy. B theocracy C monarchy D democracy

Answers

The answer for this is; Monarchy.

Answer: C. Monarchy

Explanation: Mesopotamia, the ancient empire on the land of Asia, was devoted to the system of the kingdom, that is, the monarchy ruled by the king, the emperor. There was a system of clergy, with the proclamation of zoroastrianism mainly, and the priests were often advisers of kings and emperors. In ancient Greece, most of the city-states were ruled by kings. Athens was an exception that developed democracy at some point.

Plz help

Imagine you are a settler in William Penn’s new colony, Pennsylvania.
Write a letter of at least two paragraphs that describes your life to your friends back in England.

Answers

Try this one. It would be about you though. Alright?  My life in Pennsylvania. I got the chance to maintain a friendly relation with some of the local American Indians.

If your on edge this is the answers i gives when you go to check your response to a sample response . ITS RIGHT FOR ANYONE THOU!!!

The land is fertile and our family owns it.

We have peaceful relations with  American Indians.

We are allowed to openly practice our Quaker religion.

Food is plentiful and the weather is nice.

We miss our friends back in England.

The wilderness is scary and     overwhelming.

please mark brainlest

Other Questions
James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Steam Workshop Downloader