What did Bonzo say when he saw the Ivy-coverd walls of the Ivy League collage?

Answers

Answer 1
Final answer:

Bonzo said that after the wallpaper was changed it would be the heavy bedstead, and then the barred windows, and then that gate at the head of the stairs, and so on.

Explanation:

The Ivy League refers to a group of eight prestigious private universities in the United States known for academic excellence, selectivity, and a strong reputation. Established in the northeastern part of the country, the Ivy League schools include Harvard, Yale, Princeton, Columbia, Brown, Dartmouth, Cornell, and the University of Pennsylvania. These institutions are often associated with a rich history, rigorous academic programs, and a tradition of producing successful leaders in various fields.

Admission to Ivy League schools is highly competitive, and they are widely regarded as some of the top higher education institutions globally. Bonzo said that after the wallpaper was changed it would be the heavy bedstead, and then the barred windows, and then that gate at the head of the stairs, and so on.

Learn more about Bonzo's reaction to Ivy League college walls here:

https://brainly.com/question/10927751

#SPJ2

Answer 2

Bonzo humorously remarked when seeing the Ivy-covered walls: "I guess this is what they mean by 'Ivy League'!"

Bonzo’s statement plays on the literal appearance of the ivy-covered walls and the term 'Ivy League,' which refers to a group of prestigious universities in the United States. The Ivy League is known not only for its academic excellence but also for its historic and picturesque campuses, many of which are adorned with ivy. Bonzo humorously interprets this characteristic as the defining feature of these universities. This joke underscores the literal and figurative meanings of the term, highlighting both the physical prevalence of ivy on the buildings and the metaphorical 'ivy' of tradition and prestige that these institutions are known for. This type of humor, using wordplay, is often employed to provide a light-hearted take on serious subjects.


Related Questions

Could you check my answer please..thank you Which of the following sentences contains a linking verb?
A. Yesterday, Sarah experienced rock climbing for the first time.xxx
B. Sarah seemed nervous at first. C. She climbed very well for a beginner. D. I think Sarah wants to go again. Thank you

Answers

The correct answer is option B. The sentence that contains a linking verb is Sarah seemed nervous at first.

A linking verb (or copular verb) connects the subject of a sentence with a subject complement, which describes or identifies the subject. In sentence B, seemed is the linking verb that connects the subject Sarah to the subject complement nervous. The word nervous describes Sarah's state or condition.

Yesterday, Sarah experienced rock climbing for the first time.

The verb experienced is an action verb, indicating an action Sarah performed.She climbed very well for a beginner.The verb climbed is an action verb, describing the action of climbing.I think Sarah wants to go again. The verbs think and wants are action verbs. Think expresses the action of forming a thought, and wants expresses the action of desiring something.

Therefore, only sentence B fits the criteria of containing a linking verb (seemed).

The complete question is

Which of the following sentences contains a linking verb?

A. Yesterday, Sarah experienced rock climbing for the first time.

B. Sarah seemed nervous at first.

C. She climbed very well for a beginner.

D. I think Sarah wants to go again.

Expressionists alter the shape of forms, and they use color as an independent expressive element. Which of these artists served as an inspiration for early expressionist?
Jackson Pollock
Mark Rothko
Vincent van Gogh

Answers

The correct answer for the given question above would be the last option. Since expressionists alter the shape of forms, and they use color as an independent expressive element, the artist that served as an inspiration for early expressionist was Vincent van Gogh. Hope this answer helps.

the answer is c on plato :)


Which sentence describes this Aztec stone calendar?


A: The glyphs on it tell the Aztec history of the world.

B: It was used as a tabletop during Aztec ceremonies.

C: It contains relief sculpture made by carving into cement.

D: The pictures on it are purely decorative.

Answers

The glyphs on it tell the Aztec history of the world is sentence describes this Aztec stone calendar. Thus, option (a) is correct.

What is Aztec?

Aztecs are a name for the also known as the people of the Aztlan. In the post-classical era, 1300–1521, the Aztecs were the most popular Mesoamerican culture. Aztec architecture, land use, agriculture, and artistic creations have made them famous.

During the Aztec period, the degree of understanding was complicated mathematics. The Aztecs are also known as the Aztlan people. The sophisticated calendar is useful for medicine, learning, and remembering everything. The Aztec technology was the beneficial to the people. Aztec stone calendar was the famous in the world.

As a result, the glyphs on it tell the Aztec history of the world is sentence describes this Aztec stone calendar. Thus, option (a) is correct.

Learn more about on Aztec, here:

https://brainly.com/question/11253411

#SPJ2


Look closely at the image above. Which of the following is not true?
a.
This is an example of a gouache painting by Joseph Solman.
b.
As with watercolor, to create this painting, the artist combined water with pigment. However, he/she also added white pigment in order to produce a tinted feel.
c.
The man in the image is the artist himself. This is easily recognized because the artist painted his back, which is common when artists created self-portraits.
d.
Although there is a hazy look to the man in the picture, the artist did used definitive, strong lines throughout the piece.

Answers

c.

The man in the image is the artist himself. This is easily recognized because the artist painted his back, which is common when artists created self-portraits.

The man in the image is the artist himself. This is easily recognized because the artist painted his back, which is common when artists created self-portraits is not true. Thus, option C is correct.

What is the image?

Any artificially manufactured or manipulated visual component as well as any artificially changed or transformed visual object.

As in this painting it is the third option is not correct. Because it suggest that the artist is painting his back there is artist can't see their back. Also it is not common for an artist is to create their own self-portrait.

As they cannot see clearly what is at what also he is given nothing so that clearly admit sir they are not to take picture or an article is creating the image which is given.

Therefore, option C is the correct option.

Learn more about images, here:

https://brainly.com/question/1809747

#SPJ5

Witch materials did artists use for the decoration of their works

Answers

African art. Hope that I helped.

Which of these early historians was more concerned with clearly presenting facts than telling an interesting story?

A. Herodotus
B. Thucydides
C. Homer
D. Tacitus

Answers

Final answer:

Thucydides was the early historian who prioritized presenting facts clearly over the storytelling aspect, contrasting with Herodotus who often included anecdotal elements. Option b is the answer.

Explanation:

The early historian more concerned with clearly presenting facts rather than telling an interesting story was B. Thucydides. Thucydides is often referred to as the "father of scientific history" because he adhered to strict standards of evidence-gathering and analysis of cause and effect without concern for myth or entertainment. In contrast, Herodotus included more anecdotal and entertaining elements in his writings, which sometimes led to inaccuracies.

Final answer:

Thucydides is known for his factual and analytical approach to writing history, notably in his work on the Peloponnesian War, making him more concerned with presenting facts than crafting engaging narratives compared to the other historians listed.

Explanation:

The question asks: Which of these early historians was more concerned with clearly presenting facts than telling an interesting story? Among the historians listed, B. Thucydides is notably recognized for his commitment to presenting facts and analyzing the causes and effects of human actions with objectivity. Thucydides wrote the History of the Peloponnesian War, displaying a rigorous approach to historical writing that prioritizes factual accuracy and critical analysis over the weaving of engaging narratives. His work is characterized by a meticulous examination of events, political dynamics, and human motivations, making him a pioneer in the methodological approach to history that closely resembles modern historiography.

In contrast, Herodotus, often considered the "Father of History," blended factual reporting with storytelling, sometimes including myths and legends, to make his accounts more engaging. Homer is more accurately described as a poet rather than a historian, and his works are primarily narrative epics rather than factual histories. Tacitus, a historian of ancient Rome, though concerned with factual accuracy, also infused his narratives with moral evaluations and rhetorical elements. Therefore, Thucydides stands out as the historian who placed the highest emphasis on clearly presenting facts over storytelling.

How does shakespeare manage to accomplish the escalate of suspense in hamlet act 2

Answers

He had two seperate plot developments happen at the same time. He also forshadowed and Hamlet going mad a little. Even though in this scene it was suppose to be faked. The scenes would be what Gertrude, which includes the discussion with the ambassadors; Hamlet’s conversation with Polonius, in which we see Hamlet consciously feigning madness for the first time; Hamlet’s reunion with Rosencrantz and Guildenstern; and the scene with the players, followed by Hamlet’s concluding speech on the them. These separate plot developments take place in the same location and occur in rapid succession. This causes suspense to build for it leaves us wandering what can happen next.
-
https://answers.yahoo.com/question/index?qid=20110216211437AApVcq1

He simultaneously made two different narrative developments happen. He hinted that Hamlet may become a little insane as well. Even if the deception in this scenario was intended.

How does Shakespeare build suspense in Hamlet?

The presence of the spirit and the characters' responses to it both contribute to the tension. Ghosts are not a figment of the author's imagination in Hamlet. Since everyone can see them, they should be taken seriously. The spirit resembles Kind of Denmark, who passed away recently.

The scenes would be the talk between Hamlet and the diplomats in What Gertrude; his reunion with Rosencrantz and Guildenstern; and the scene with the players, which is followed by Hamlet's last statement on them. These several story developments all take place simultaneously in the same setting. This makes us wonder what may happen next, which heightens the suspense.

Learn more about Shakespeare, here:

https://brainly.com/question/25603233

#SPJ2

Byzantine art production ended with the conquest of constantinople in 1453. true or false

Answers

false the history of art continues on and doesn't end with the demise of the conquest of Contsantinople 

Answer:

100% False

Explanation: I just did the lesson and got the question right

Which of the following statements best describes James Auduborn’s intentions when he painted, Wild Turkey?
a.
He intended to portray the bird realistically, and yet also show its unique and beautiful qualities.
b.
He intended to change people’s perception of the wild turkey, by showing how beautiful it can be when looked at through an artistic eye.
c.
He intended to show the gracefulness of a wild turkey in motion.
d.
He intended to do all of the above through his painting, Wild Turkey.

Answers

Okay, I like how my answer got deleted but look at that persons. The answer is A. You're welcome. 

Answer:

a

Explanation:

Texture can be the ____(1)____ of a design. With texture, lines and surfaces can be described as ____(2)____ and ____(3)____.


Please select the best answer from the choices provided
(1) color; (2) zigzag; (3) curvilinear
(1) line quality; (2) smooth; (3) rough
(1) line quality; (2) dimensional; (3) smooth
(1) form; (2) deep; (3) shallow

Answers

The answer is line quality, smooth, rough

Answer:

Texture can be the line quality of a design. With texture, lines and surfaces can be described as smooth and rough.

Explanation:

Rough or smooth, warm or cold, texture is the characteristic of surfaces that alludes to the senses.

Texture is the heart of design, being the determining quality of the delicacy of the surfaces. It is also a determining factor in defining the material from which the present figures are made.

When it comes to texture in design, we have to keep in mind that the very materials from which visual communications are made produce or have texture.

A painting, for example, can be done on rough cloth such as jute or smooth as silk. So too, brushes produce texture. A mink fur brush produces a smooth, smooth brush that has almost no texture. Already a pig hair brush produces a rough and irregular visual.

Where have many of the best preserved ancient artworks been found?

Answers

I would say most likely found in the tombs of Egypt

what is the lithography technique?

Answers

The printing is from a stone (lithographic limestone) or a metal plate with a smooth surface. It was invented in 1796 by German author and actor Alois Senefelder as a cheap method of publishing theatrical works.Lithography can be used to print text or artwork onto paper or other suitable material.
Engraving is a type of lithograpic technique

What band was dave grohl in before nirvana? queen, foo fighters, or scream?

Answers

The answer is Foo Fighters.

Answer:

The correct answer is Scream.

Explanation:

Before Dave Grohl became the famous drummer of Nirvana, he was in the band Scream. (from 1986 to 1990) Grohl joined Nirvana in 1990.

hope this helps! :)

Which of the following composers is credited with helping to establish the genres of symphony and string quartet?
A. Franz Joseph Hayden
B. Wolfgang Amadeus Mozart
C. Gioachino Rossini
D. Ludwig van Beethoven

Answers

The correct answer of the given question above would be option A. The composer who is credited with helping to establish the genres of symphony and string quartet is Franz Joseph Hayden. Haydn also composed symphonies, string quartets, and other chamber music. Hope this answer helps. 

Answer:

A.   Franz Joseph Haydn

Explanation:

    Franz Joseph Haydn (1732-1809) is considered the "Father of the Symphony." He composed more than 100 of them, as well as 83 string quartets and dozens of creations in various instrumental, vocal and profane genres. He spent at least half a century working for music. The second movement of his 1797 “Emperor” Quartet was later adopted as Germany's National Anthem.

which period of music was the most diverse?

A.middle ages
B.renaissance
C.romantic period
D.twentieth century

Answers

The correct answer is option D. The period of music was the most diverse  twentieth century.

The twentieth century was the period of music that exhibited the most diversity.

Middle Ages:

Music during the Middle Ages was primarily focused on sacred music and chant, with relatively limited harmonic and rhythmic complexity compared to later periods.

Renaissance:

The Renaissance saw a resurgence of interest in humanism and artistic expression, but music was still largely dominated by polyphonic vocal music and relatively restrained in terms of stylistic diversity compared to later periods.

Romantic Period:

While the Romantic period was known for its emotional expression and expansion of orchestral and operatic forms, it did not exhibit the same level of stylistic diversity as the twentieth century. The focus was more on individual expression within a somewhat unified harmonic language.

Therefore, the twentieth century stands out as the period of music history that was the most diverse in terms of style, technique, cultural influence, and experimentation.

What are all the tertiary colors?

Answers

For the six RYB hues intermediate between the RYB primary and secondary colors, the names amber/marigold (yellow–orange), vermilion/cinnabar (red–orange), magenta(red–purple), violet (blue–purple), teal/aqua (blue-green), and chartreuse/lime green (yellow–green) are commonly found
Tertiary colors are the resulting color formed when an equal amount of a primary and a secondary color are mixed. The primary and secondary color must be beside each other on the color wheel. For example, a mixture of 50-percent red and 50-percent magenta would result in the tertiary color of orange.

Fill in the blank. The Late Classical Greek art period saw a new, detailed characterization of _________ in the visual arts.

Answers

The Late Classical Greek art period saw a new, detailed characterization of figures in the visual arts.
Statues and sculptures were completely different than in previous periods of Greek art - they changed from vaguely represented to highly detailed figures.

1.) The solfege syllable for the dominant note G is ________
A. do
B. ti
C. fa
D. sol

2.) which of these intervals is a half step
A. G to A-flat
B. E to F-sharp
C. C to B-flat
D. all of the above

3.) which of these intervals is a half step?
A. G to A-flat
B. E to F-sharp
C. C to B-flat
D. all of the above

4. the interval between any note and its nearest neighbor with the same letter name called _______
A. and octave
B. a unison
C. a third
D. a fifth

5. a sharp symbol next to a note makes that note ________
A. one half step higher
B. one whole step higher
C. one half step lower
D. one whole step lower

Answers

Number one is D sol.
I'll give you the answer and also I'll provide you with the illustration. It heps to get the idea of sharps, steps, half-steps etc. Very useful thing. You can use it as these topic is tricky enough. So here are the answers: 
1.The solfege syllable for the dominant note G is D. sol.
2. C. C to B-flat 
3. A. G to A-flat 
4. The interval between any note and its nearest neighbor with the same letter name called A. and octave.
5. A sharp symbol next to a note makes that note A. one half step higher 
I hope everything is clear with note circle.

The above piece of art is a replica of what type of religious art?
a.
monogram
c.
stained-glass window
b.
painting
d.
engraving

Answers

The piece of art in the attached image is called a "stained-glass window." They are often found in cathedrals and churches.

Answer:

C

Explanation:

I just took the test is right

Meagan became a costume designer because she enjoyed spending time and sharing ideas with others interested in movies. Which of the following best describes why Meagan works?


a.

to pay for wants and needs


b.

to be around others


c.

to make a contribution


d.

to be self-fulfilled

Answers

Meagan, who has became a costume designer because she enjoyed spending time and sharing ideas with others interested in movies works because she wants to to be around others . Correct answer: B Working with others and feeling that she belongs to a one working group is Meagan's motivation.


Answer:

B. to be around others

Explanation:

Which popular orchestral form was Haydn instrumental in creating?
A, concerto
B, symphony
C, mass
D, opera

Answers

I think Bbbbbbbbbbbbb

Answer:

B, symphony

Explanation:

    Franz Joseph Haydn is considered the "Father of the Symphony". He composed more than 100 of them, as well as 83 string quartets and dozens of creations in various instrumental, vocal and profane genres. He died at 77 and spent at least half a century working for music. The second movement of his 1797 “Emperor” Quartet was later adopted as Germany's National Anthem.

What does a painter need to do create a linear perspective?

Answers

Answer:

establish a horizon line and a vanishing point

Explanation:

just took the test

Artists establish a horizon line to create effective linear perspective, a vanishing point on that line, and multiple orthogonal, or vanishing, lines.

The horizon line is a horizontal line that runs across the paper or canvas to represent the viewer's eye level and delineate where the sky meets the ground.

What is a linear perspective?

Linear perspective is a technique used by artists to create the illusion of depth and space using relative size and position of a group of objects. To achieve this effect, there are three essential components needed in creating a painting or drawing using linear perspective.

Learn more about Linear perspective here,

https://brainly.com/question/11833253

#SPJ2

Which statements about the artworks of Raphael are true?

Choose all answers that are correct.

A.
They show the personalities of people.

B.
They depict people just as they looked in real life, without ideal beauty.

C.
They show the influence of Leonardo, Michelangelo, and Classical art.

D.
They use chiaroscuro to give figures a sense of solid form.

Answers

The correct answer is B. They depict people just as they looked in real life, without ideal beauty and D.They use chiaroscuro to give figures a sense of solid form.

This was quite common not only with Raphael, but with many artists from the period. He was just the one that excelled since his skill was unparalleled.

Answer: Its B and D I was taking the test and searched brainly thats wht a lot of people said. :p

The Incas used what material to help harden the metals they used in their art?

Answers

The correct answer for the given question above would be ARSENIC. The Incas used ARSENIC material to help harden the metals they used in their art. Arsenic is considered as a metalloid. Not entirely a metal but possesses the properties of a metal. Hope this answers the question.

Answer:

ARSENIC

Explanation:

Please Help!!!!

How did Egyptian artists and architects create works that reflect the beliefs of ancient Egyptian civilization?

A. The featured many kinds of animals to show their importance in Egyptian civilization

B. They commemorated military heroes, reflecting their high craftsmen played in Egyptian civilization.

C. They focused on the important role that laborers and craftsmen played in Egyptian civilization

D. They glorified Egyptian royalty and gods to reflect their importance in society

Answers

A. The featured many kinds of animals to show their importance in Egyptian civilization

Answer:

D. They glorified Egyptian royalty and gods to reflect their importance in society

Explanation:

    Egyptian Art was born over 3000 years BC and is linked to religiosity, as most of its statues, paintings, monuments and architectural works are manifested in religious themes.

    Thus, the interior of the temples, as well as the pieces or spaces related to the cult of the dead, were artistically elaborated. Tombs are one of the most representative aspects of Egyptian art.

What Latin verb does the term, Intaglio, come from? What does the verb mean in Latin? What date and society can Intaglio be dated back to?

Answers

Here are the answers to the given questions above.
The Latin verb that the term Intaglio come from is intaliare and this verb means to cut in Latin. Intaglio can be dated back to c. 4000 BCE. This is the most ancient form of gem engraving and was common to the Babylonian times. Hope this is the answer that you are looking for.

Intaglio come for the Latin verb, itagliare. In Latin, intagliare means “to cut”. Intaglio can be dated back to the Sumerian society, around the year 3000 BCE.

how are art and conservation science connected in this sculpture?
A. The artists was repurposing materials to create art
B. The artists only used brand-new materials to create art.
C. the artists created a piece that could not be sen by others
D.The artists used chemical reactions of materials to create the sculpture
My answer is A.

Answers

I agree with you. I agree because Conservation Science is the science of conserving things such as the materials not being used and thrown out. Of course, doing art with these materials is a way that you can see in our world
Final answer:

Art and conservation science are connected in a sculpture when artists reuse or repurpose materials. This represents both artistic creations and embodies the principles of conservation science, focusing on waste prevention and responsible resource use.

Explanation:

The connection between art and conservation science in a sculpture can be observed when artists repurpose materials to create their artwork. In the given multiple-choice question, the correct option was A. The artist was repurposing materials to create art. In this scenario, the artists make use of old or discarded items, such as metal, wood, or plastic, giving them new life and purpose in the form of a sculpture. This act not only represents artistic creation but also embodies the principles of conservation science, which aim to prevent waste and promote recycling and responsible use of resources.

Learn more about Art and Conservation Science here:

https://brainly.com/question/38873083

#SPJ3

Plaster of Paris is often used to create casts of impressions today.
True
False

Answers

True! Plaster of Paris is often used to create casts of impressions today. It is commonly used because it has gypsum cements which easily turn into a solid.
Final answer:

Plaster of Paris is commonly used to create casts of impressions in both the medical and art fields because it hardens upon mixing with water, enabling it to capture fine details.

Explanation:

In chemistry, Plaster of Paris is indeed frequently used today to create casts of impressions. It continues to be used in the medical field to form casts for broken bones and in the arts for the creation of sculptures and moldings. This is primarily because Plaster of Paris, which is calcium sulfate semi-hydrate, becomes hard when mixed with water due to its ability to re-form into calcium sulfate dihydrate. This process, known as setting, allows the capture of detailed impressions.

Learn more about Plaster of Paris here:

https://brainly.com/question/30402736

#SPJ12

Elizabethan England is most famous for which art form?

frescoes

madrigals

drama

epic poetry

Answers

Elizabethan England is most famous for the art from known as drama. Plays were very important at the time, and during Queen Elizabeth's reign, many popular playwrights wrote, such as William Shakespeare, Christopher Marlowe, Ben Jonson, etc. Although other forms of literature were written then, plays were by far the most numerous at the time.Hope this helps. Let me know if you need additional help!

Answer:

Drama

Explanation:

Elizabethan Era is most famous for the theatre and the works of William Shakespeare. Opening of the Red Lion theatre in 1567 marked the beginning of Renaissance theatre. After it many theatres started in London. The Elizabethan period produced some of the great playwrights such as William Shakespeare and Christopher Marlowe. Popular genres of the Elizabethan period included history play, the comedy and the tragedy. Apart from Art music and painting also flourished.

This sculpture is called the Human-headed Winged Lion. It was intended to represent which of the following?
a.
It represents the strength of the ruler it defended.
b.
It represents what the achievements of the Sumerian society.
c.
It represents the fertility of the Crescent and the conquering strength of its ruler.
d.
It represents all of the above.

Answers

eh... I'd have to say all of them. but if you're iffy about that answer... Chose Option choice A. 

It represents the strength of the ruler it defended. This sculpture is called the Human-headed Winged Lion. Hence, option A is correct.

What does the human headed winged lion represent?

The item was created to make people feel safe. A Lamassu is a mystical protector god. Each element, including the strength of a lion, the swiftness of a bird, and the intelligence of a human head, serves as an important symbolic representation. The artwork represents a time when gods were revered in statues or temples.

Nearly five meters tall and 40 tons in weight, this winged bull. Large sculptural fragments discovered in Khorsabad were transferred to Chicago in cartons, where they were brought into the OI Museum via the gallery wall in 1930 as it was being constructed.

Thus, option A is correct.

For more details about human headed winged lion represent, click here:

https://brainly.com/question/14679361

#SPJ2

Other Questions
"lucy owns a bakery in 2006 she sold pies for $9.50 each in 2010 she sold pies for $17.50. Find the rate of change for the price of a pie from 2006 to 2010" Si te gusta estudiar, leer y escribir cuentos eres write 2.18 as a mixed number in simplest form Find the Nth term of the following sequence...7, 27, 47, 67, ..... Marvin is trying to finish 1/2 of his test every 2/3 hour. How many hours will it take Marvin to complete his whole test List the integers between the square root of 15 and the square root of 48 ? Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Steam Workshop Downloader