(Will mark brainliest, direct answer is preferred)
Which sequence shows the correct path of blood flow between the heart and lungs?
right ventricle, lungs, left atrium
right atrium, lungs, right ventricle
left atrium, lungs, left ventricle
left ventricle, lungs, right atrium

Answers

Answer 1

Answer:

Right ventricle, lungs, left atrium

Explanation:

The pathway of blood in the heart and lungs follows this order:

The body -> Superior and inferior vena cava -> Right atrium -> tricuspid valve-> right ventricle-> pulmonary semilunar valve -> pulmonary artery -> lungs-> pulmonary vein -> left atrium-> bicuspid valve -> left ventricle- aortic valve-> Aorta-> the body

So not counting the valves and the vessels, the best answer would be the first option.

It would also be good to remember that unoxygenated blood starts in the right side of the heart and the oxygenated blood starts in the left side of the heart.

Ventricles pump blood and atria receives blood. The right atrium receives blood from the lungs, while the left atrium receives blood from the body. The left ventricle pumps blood towards the body, while the right ventricle pumps blood towards the lungs.


Related Questions

How is an egg fertilized in flowering plants?


A.
with sperm


B.
by spores


C.
with an ovule


D.
with embryos

Answers

Answer: A. with sperm

Explanation:

Nitrogen oxide is released when _____. hydrocarbons combine with water plants make food through photosynthesis special bacteria break down nitrogen fuels are burned at high temperatures

Answers

Answer:

Nitrogen fuels are burned at high temperatures

Explanation:

When the nitrogen-based fuel is burned at high temperatures, the nitrogen in the fuel combines with oxygen to form nitrogen oxide. While this can occur n combustion engines in cars, leading to pollution, the same occurs naturally espically during lightning strikes that cause the nitrogen gas in the atmosphere combine with oxygen. NO is an airway irritant.

Answer:

it´s D I got it correct

In order from less complex to more complex, which level of organization is directly after tissue?

Answers

Elements. Knowledge of basic science includes the distinction between atoms and molecules, and elements, mixtures and compounds. ...

Molecules. The size of molecules varies enormously depending on the type of molecule.

Organelles.

Cells.

Tissues.

Organs.

Organ Systems.

Organism.

Answer:

a

Explanation:

hope it helps

Chapter8 lesson 2 cell structure

Answers

Answer:

Can you give me more details about this question?

Answer:

wdym

Explanation:

Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.

Answers

Answer:

C. It is caused by a virus, not a bacterium

Explanation:

The answer is C influenza is caused by viruses not a bacterium

viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood

The Serengeti plains are part of the African savanna ecosystem and are home to a variety of different species of plants and animals. The Serengeti plains experience a seven-month period of seasonal drought each year, during which the ecosystem receives only four inches of rain and the availability of some resources becomes very scarce. Which type of limiting factors does the seasonal drought in the Serengeti plains affect?

Answers

Answer:

Water is the limiting factor that the Serengeti plains affect.

Explanation:

From the explanation, Serengeti plains experience a seven-month drought during which only 4 inches of rain is received.

This is a limiting factor that maimes the growth and spread of organisms across the plain.

Due to less amounts of rainfall, there shall be minimal growth of vegetation, this in turn shall lead to loess supply of food for organisms and hence higher mortality rate and low birth rate.

Answer:

density- independent factors

Explanation:

Frost wedging happens when__

Answers

Answer:

Frost wedging occurs as the result of expansion of water when it is converted to ice. Cracks filled with water are forced further apart when it freezes.

Answer: The correct option is water freezes inside a rock, causing it to break

Explanation:

How does introduced species harm our planet?
Please someone answer this
ASAP!!!

Answers

Introduced species can harm our planet because in some regions of the world we are not prepared for their type of species, which can all in all cause damage.

Answer: alteration of the ecosystem

Explanation:when a new specie is introduced into the ecosystem it may have profound affects in the ecosystem and may also be called an invasive specie.

The affects that it may have on the ecosystem include

1.outcompeting the native specie and sometimes even leading to their extinction because the new specie may be modified in such a way as to have better chances of survival in the ecosystem because of their evolved genetics e.g : the new specie may encounter a native and non evolved specie of the ecosystem and compete with it for survival leading to reduction and even complete eradication of the native specie

A geologist concludes that a rock sample is an extrusive igneous rock. Based on this information, which statement about the rock is accurate?

A. The rock formed from cooling lava.
B. The rock likely came from a pluton.
C. The rock cooled slowly over millions of years.
D. The rock formed within Earth's crust.

Answers

The correct answer is D

The accurate statement about an extrusive igneous rock is that it formed from cooling lava, which cools quickly at the Earth's surface, leading to a finer-grained texture.

Based on the information that a geologist concludes a rock sample is an extrusive igneous rock, the accurate statement about the rock is A. The rock formed from cooling lava. Extrusive igneous rocks such as basalt are formed above the surface when molten rock, known as lava, extrudes onto the Earth's surface and cools quickly. This rapid cooling does not allow large crystals to form, leading to a finer-grained texture, and in some cases, such as with obsidian, a glassy texture due to the extremely rapid cooling.

Option B is incorrect because rocks that come from plutons are intrusive, rather than extrusive, and they cool slowly within the Earth's crust. Option C is incorrect as extrusive igneous rocks do not cool slowly over millions of years. Option D is also incorrect because extrusive igneous rocks form at the Earth's surface, not within the Earth's crust.

what are two ways variation in the trait could be introduced into the population?

Answers

A single mutation can have a large effect, but in many cases, evolutionary change is based on the accumulation of many mutations. I hope this help you

Answer:

i sai sai

Explanation:

sia sia sai In a running relay, each runner ran an equal part of the total distance.  Joseph and 3 othe

What happens to a virus involved in the lysogenic cycle?

Answers

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

A group of environmental activists in West Virginia wants to save a large forest. Which act will help them in this activity?

1. Nature conservancy
2. Toxic substance control act
3. Eastern wilderness areas act
4. Endangered species act

Answers

Answer:

A

Explanation:

Answer: 1. Nature conservancy

Explanation:

Nature conservancy is the process or initiative taken by the human society to conserve the regions of forests and the associated wildlife, fossil fuels, water sources and others. This practice will ensure that the valuable resources will remain available for the present as well as for the future generation of human beings.

On the basis of the above description, nature conservancy is the activity which will help the environmental activists to save the forests.

Can a tornado pick up a person and send it to another island?

Answers

Answer: almost imposiable

Explanation: If you do happen to get picked up a tornado the longest time you will stay in it is approximately 5 minutes before it throws you out of it. If you did so happen to be swept in a tornado near a island it is possiable, but tornados over water die very very fast so this is very unlikley.

Hope this helps

Answer:

Nope.

Explanation:

Now I don't know anything about much about tornado's. But I'm pretty sure it won't pick up that person and send it to another island. I don't think the tornado have enough force to throw the person to another island. It will, however, send that person on another area maybe close to the tornado area. But yet again I don't the tornado have the abilty to do that.

Why do geese fly together in a V formation?

Answers

Explanation:

Geese fly together in a v formation.

Geese fly together because when the first goose flaps it's wings it creates an upward force which make it easier for the second goose to fly.

In this way the force increases and the effort the last goose has to spend to fly decreases a lot.

Hope it helps you.

please mark as brainliest.

Answer:

B. to save energy

Explanation:

ody ssey Unit 3, Assignment 2. Animal behavior and Interdependencies, page 4, under Group Animal Behavior, paragraph 2, from " The lead goose....V formation.....making their flight easier."  

nowhere in my ody ssey unit materials did it mention otherwise or geese again.  

Which part of a mushroom can you see above the ground?

Answers

Answer:

The correct answer is reproductive part.

Explanation:

The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.

The history of Taurus

Answers

Answer:

The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle. The sign of Aries represents the beginning of spring and with it the beginning of life, while Taurus is a fixed sign that continues what Aries has started. Life is in full bloom in the sign of Taurus.

The stars in Taurus constellation host two open clusters, the Pleiades and the Hyades and are mostly located at the end of the sign of Taurus and the beginning of the zodiacal sign of Gemini. In the Early Bronze Age it marked the location of the Sun during the spring equinox, just like the constellation of Aries represented the equinox over 2000 years ago. The constellation of Taurus was linked to it 5000 to 1700 BC, before the precession of the equinox moved our perspective to the sign of Aries.

Answer:

The zodiacal sign of Taurus does not coincide with the constellation of Taurus. It is a continuation of the sign of Aries and represents the second 30 degrees of the zodiacal circle.

Explanation:

How do invasive species disrupt an ecosystem? Describe at least one example of when invasive species have disrupted an ecosystem. Your example could be a plant, animal, fungus, ext. (please please please help!!)

Answers

Answer:

Explanation:

I think one of the most invasive species is perhaps the Dandelion. Who hasn't had a fit when we see them change from yellow to gray. The yellow is pretty, but the gray means it is ready to spread its seed to create more trouble.

Dandelions can be killed with herbicides, but I think you'd be as well off putting up with the dandelion. The herbicides have an unproven effect on our health.

The dandelion was introduced into the Americas in the mid 1600s and was used as food and had medical properties. Since then, because it has no common enemy in nature, it has spread the entire width of the continent. Rather amazing, I think.

When a new aggressive species is introduced into an ecosystem, it may not have any natural predators or controls. They can breed quickly and take over an area and native wildlife may not have evolved defenses against the invader. The invader also takes over the natural resources for the native species. Aggressive plant species like Kudzu can quickly replace a diverse ecosystem with a monoculture of just Kudzu. Additionally, some invasive species are capable of changing the conditions of an ecosystem, such as changing soil chemistry or the intensity of wildfires.

Figure 10-4
49
replicate DNA
a
In Figure 10-4. what role does structure A play in mitosis?
b. increase cell
connect to spindled dissolve nuclear
volume
fibers
envelope
Figure 10-5

Answers

Structure A in Figure 10-4 is the centrioles.  role does structure A play in mitosis  is: (c) connect to spindle fibers

Centrioles are paired organelles that are found in the cytoplasm of eukaryotic cells. They are composed of microtubules, which are long, thin filaments that form the structural framework of the cell. During interphase, the centrioles are located near the nucleus and are surrounded by a cloud of protein called the centrosome.

As the cell progresses into mitosis, the centrioles replicate and move to opposite poles of the cell. This process is called centrosome separation. The centrosomes act as organizing centers for the spindle fibers, which are microtubules that extend from the centrosomes and attach to the chromosomes. The spindle fibers play a crucial role in separating the chromosomes during mitosis.

(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)

What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence

Answers

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

What evidence makes scientists think that land plants evolved from green algae

Answers

Answer:

Because the algea was not strong enough yet to live on its own and had to stay close a water source, where it could get water and sunlight without doing any work.

Explanation:

Final answer:

Scientists believe that land plants evolved from green algae due to shared physical traits, biochemical pathways, and their common monophyletic heritage. These include similar mechanisms of cell division, storage of starch, the presence of chlorophyll as a photosynthetic pigment, and being part of the same photosynthetic lineage, the Archaeplastida.

Explanation:

The evidence that leads scientists to believe that land plants evolved from green algae is rooted in various shared characteristics and evolutionary lineage. Green algae, especially the Charophytes, share several traits with land plants, such as having chlorophyll a and b as photosynthetic pigments, cellulose cell walls and starch as a storage molecule. Another crucial point to note is a common mechanism of cell division and significant biochemical pathways.

Furthermore, evolutionary thought indicates that all plants, including green algae and land plants, are monophyletic, meaning they descend from a common ancestor. The transition from water to land posed significant challenges to plants in the form of avoiding drying out, spreading reproductive cells in air, developing structural support, and capturing sunlight. Characteristics like these were developed during evolution by both green algae and land plants.

Lastly, the Archaeplastida, which includes green algae and land plants, became photosynthetic through an endosymbiotic relationship with a green, photosynthetic bacterium around 1.65 billion years ago. This lineage evolved into what we know today as red and green algae, and eventually land plants such as mosses, ferns, gymnosperms, and angiosperms. These shared traits and the evolutionary history demonstrate the strongly supported theory that land plants evolved from green algae.

Learn more about Evolution of Land Plants here:

https://brainly.com/question/12045339

#SPJ3

The action by which a plant grows toward sunlight is called _____.


response to stimulus

using energy

reproduction

movement

Answers

Answer: phototropism

Explanation: phototropism is a plant's response to light.

Plants growing toward sunlight is known as tropism, a response to stimuli.

Tropism is the action by which a plant grows toward sunlight. This growth movement is a response to stimuli where the plant or a part of it grows in the direction from which the stimulus originates.

Which process involves making glucose without energy from sunlight?
A. Photosynthesis
B. ATP formation
C. NADPH formation
D. Chemosynthesis

Answers

Answer:

Chemosynthesis

Explanation:

Its right trust me

the correct answer is chemosynthesis <3

At which region of a state's geology would an earthquake be more likely?



Near a divergent boundary of two plates


At the site of geologic uplift where island chains form


At the site of a convergent boundary as plates move together


Around a transform boundary between two plates that slide past each other

Answers

Answer:

Around a transform boundary between two plates that slide past each other

Explanation:

There are several problems with classifying organisms into six kingdoms of life. One problem is that _______ aren't well defined and are very diverse. In addition, any eukaryotes that don't fit into other kingdoms are placed in this kingdom. A. fungi B. plants C. archaea D. protists

Answers

Answer:

D. Protists

Explanation:

Kingdom protista is composed of mostly unicellular organisms, but they do include some multicellular organisms. Like your problem says, eukaryotes that do not fit in other kingdoms are placed in this kingdom. As a result, even members of this kingdom do not share many similarities, as the organisms here are diverse.

The answer is D. Protists

Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology

Answers

Answer:taxonomy

Explanation:

Modern Taxonomy

Carolus Linnaeus it credited with developing the scientific naming and classification system.

Hope this helps!!

How is a scientific law different from a scientific theory?

A. A theory becomes a law after a long period of time has passed.

B. theory is why something happens and a law is how something happens.

C. A theory cannot be disproved but a law can be disproved.

D. A theory is used for biology and chemistry and a law is used for physics.

Answers

Final answer:

A scientific law is a concise statement that describes a pattern or behavior in nature, while a scientific theory is a more complex and dynamic explanation of a group of related phenomena.

Explanation:

A scientific law is a concise statement that describes a pattern or behavior in nature that is supported by evidence and repeated experiments. Laws are often expressed in the form of a single mathematical equation. On the other hand, a scientific theory is a more complex and dynamic explanation of a group of related phenomena. Theories attempt to explain why nature behaves the way it does, while laws describe what happens.

Final answer:

A scientific law describes how something happens using a concise pattern in nature, often expressed as a mathematical equation, like F = ma for Newton's second law of motion. A scientific theory is a more complex explanation of why phenomena occur, such as the Theory of Evolution or the Theory of Relativity, and evolves over time as new evidence is found.

Explanation:

The question on how a scientific law is different from a scientific theory can be best answered by choice B: A theory explains why something happens and a law describes how something happens. A scientific law uses concise language to express a generalized pattern observed in nature, often supported by significant scientific evidence and can be demonstrated through repeated experiments. Laws can typically be distilled into mathematical equations or principles. An example is Newton's second law of motion, represented by the equation F = ma, which describes the relationship between force, mass, and acceleration.

On the other hand, a scientific theory is more complex and dynamic, providing an overarching explanation for a group of related phenomena based on a body of evidence. Theories, such as the Theory of Evolution or the Theory of Relativity, are comprehensive and explain why things occur as they do in nature. They are not concise enough to be summarized into a single equation or statement. Unlike a law, a theory does not transform into a law over time; they continue to evolve as new evidence emerges.

Solve this Sex-Linked traits practice problem

Answers

We know that hemophilia is a recessive trait, and the only way to express a recessive trait is to have a homozygous mixture. So, the genotypes probably look like this:

BB = normal blood clotting
Bb = carrier for hemophilia
bb = hemophiliac

Because the mother does NOT have hemophilia, we will be using BB x Bb to find out the alleles of their children. Because this is sex-linked traits practice, our alleles will be the following.

normal = X^BY
(uppercase B represents no hemophilia)

X^BX^b

Let’s cross them and see what we get!

X^B Y

X^B | X^BX^B X^BY

X^b | X^BX^b X^bY

As you can see, 0/4 of the females (represented by XX) will have hemophilia. Again, it is only present when there are two recessive alleles and none of them satisfy that.

2/4 of the females will be carriers (X^BX^b).

As for the boys, 1/4 will have normal clotting and 1/4 will have hemophilia. None of the males will simply be carriers.

I hope I helped!
Feel free to ask me for more assistance (if needed); I’ll gladly help! :)



Why is carbon dioxide considered a greenhouse gas? (A) It is released when fossil fuels are burned. (B) It is part of the carbon cycle, which is also known as the greenhouse cycle. (C) It can absorb infrared radiation. (D) It is responsible for protecting organisms from UV radiation.

Answers

Answer:

C It can absorb infrared radiation

Explanation:

Which of the following is not true of most sex-linked traits?

A. Located on the X chromosome
B. Located on the autosomes
C. Usually recessive
D. Usually seen in males

Answers

Answer:

a

Explanation:

Final answer:

Sex-linked traits refer to those associated with genes located on sex chromosomes. They are typically recessive and more common in males. The statement that these traits are located on autosomes, which are non-sex chromosomes, is incorrect.

Explanation:

In studying genetics, we learn that sex-linked traits are primarily associated with genes located on sex chromosomes. These traits, more often than not, are recessive and more common in males, as they carry only one X chromosome and, therefore, express all traits that are linked to this chromosome.

Yet, the statement that sex-linked traits are located on autosomes is not true. Autosomes are all the other chromosomes that are not sex chromosomes. Hence, the answer to your question is option B: Sex-linked traits are not located on the autosomes.

Learn more about Sex-linked Traits here:

https://brainly.com/question/1381309

#SPJ3

The information contained in the table could be used _______________________.

Answers

Can you attach the table so I can see it??

Answer:

A

Explanation:

to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.

Other Questions
What is the solution to the equation what where two reasons for the rapid spread of slavery in the american colonies a principle of Quality Medical Care is to receive treatment in a timely fashion Groins allow sand to pile up because it slows the longshore current down.a.True b.False You drop a ball from a height of 0.5 meters. Each curved path has 52% of the height of the previous path. a. Write a rule for the sequence using centimeters. The initial height is given by the term n = 1. b. What height will the ball be at the top of the sixth path? Which of the following could be the graph of this equation? Read the excerpt.How many loved your moments of glad grace, And loved your beauty with love false or true, But one man loved the pilgrim soul in you, And loved the sorrows of your changing faceIn this excerpt from When You Are Old by William Butler Yeats, how is the love of one man different from the others who have loved the woman?He loved the beauty of her face.He loved with a love that was both false and true.He loved her when she was not beautiful or graceful.He loved how she seemed out of place. How is 93081 rounded to the nearest thousand Marlye posted a story on her blog. On the first day there were 80 responses and on the second day there were 180 responses. What percent is the increase, 100, of the original number of responses, 80?55%80%100%125% artwork and tables can only be inserted into slides that contain a placeholder. True Or False? If you know that the combination is five digits Long how many combinations are there ?explain how you got your guess For which of the following do you need to double the final consonant before adding the suffix? shop + -er fear + -ing cost + -ly limit + -ed Type the correct answer in the box. Spell the word correctly. Complete the sentence about means of transmission. A mosquito is an example of a_________ . There are 18,076 books in our public library. How should this number be written in expanded form? A) 10,000 + 8,000 + 70 + 6 B) 10,000 + 8000 + 700 + 6 C) 18,000 + 700 + 60+ 0 D) 18,000 + 70 + 60 + 0 Which action is a way to best help remove the personal barrier of eating fast food? Skip eating a meal. Plan meals ahead of time. Purchase processed TV dinners. Eat meals in the car. el padre de luis es treinta y dos aos mayor que su hijo. si sumamos las edades de ambos el resultado es sesenta y ocho aos. qu edad tiene cada uno? It is important to follow the manufacturers recommendation on the time that you expose a print to the different chemicals. True False Find the measure of each number angle: what is the width of rectangle if the area is 40 square feet and the length is 8 feet? Oceanic plates subduct beneath continental plates because they are ______.a) more denseb) deep-sea trenchc) rift valleyd) folded mountain Steam Workshop Downloader