(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence
Answers
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Related Questions
18. What's developed as a result of the electron transport chain? A. Membrane potential B. Proton gradient C. Phospholipid bilayer D. New cells
Answers
As reduction and oxidation (electron transfer), occurs simultaneously, protons (H+) are also transported across a membrane. The result is an electromagnetic proton gradient which in turn drives the synthesis of adenosine triphosphate (ATP), which is the molecule used for energy.
The result of the electron transport chain is B) Proton gradient.
What is the electron shipping chain?The electron transport chain is a series of four protein complexes that couple redox reactions, developing an electrochemical gradient that ends in the introduction of ATP in an entire device named oxidative phosphorylation. It happens in mitochondria in both mobile breathing and photosynthesis.
What are the 3 fundamental steps in the electron transport chain?The three main steps in the electron shipping chain are:
Generation of a proton gradient throughout the mitochondrial membrane. Proton accumulation happens inside the intermembrane space of mitochondria.Reduction of molecular oxygen and formation of water.ATP synthesis by means of chemiosmosis.Hence the result of the proton gradient which is developed into the inter membrane of thylacoid or mitochondria due to H+ ions concentration.
Learn more about electrons here: https://brainly.com/question/860094
#SPJ2
8 points for one simple question.
Answers
Answer:
natural selection
Explanation:
Natural selection and is the answer
What would you say to a friend that says “GMOs are dangerous to human health?”
Answers
Answer:
Depends
Explanation:
I may start with " did you know 100% of humans who breathed air have died over the past 1000 years, its been confirmed with many sources"
depends how snarky i'm feeling.
OMG ANOTHER PERSON LEARNING BOUT GMO'S IK ALOT ABOUT IT X3 Any who this is something thats been hurting people you can so somthing like "this the reason less girls having baby's in there 20 or 30 and having baby's when there like 40 and 50" it was also something on the news i really hope this helps!!
which kingdom does this organism belong to
Answers
The five-kingdom system of classification for living organisms, including the prokaryotic Monera and the eukaryotic Protista, Fungi, Plantae and Animalia is complicated by the discovery of archaebacteria.
Answer Protista
Explanation: srry if am wrong
your youth behavior is often influenced by family and cultural experience
Answers
Not sure what the question is, but yes, it is indeed influenced by family and cultural experience.
the answer to your question is true
A student conducts an experiment to see how music affects plant growth. The student obtains four identical plants. Each one is potted in the same type of soil and receives the same amount of sunlight and water each day. Plant A listens to classical music for three hours each day. Plant B listens to rock music for three hours each day. Plant C listens to country music for three hours each day. Plant D does not listen to any music at all.
1. In the experiment described in the scenario, what's the variable?
A. The amount of water each plant receives
B. The amount of sunlight each plant receives
C. The type of soil in which each plant is potted
D. The type of music each plant listens to
Answers
Answer:
D. The type of music each plant listens to
Explanation:
The question indicates each plant is in the same soil (so cannot be C), received the same amount of sunlight (so cannot be B) and the same amount of water (cannot be A).
However, each plant is exposed to a different type of music, one is listening classical, another rock and another country music.
So, the only variable in here is the type of music each plant listens to.
Answer:b
Explanation:
what is the virus that relies on molecules called reverse transcriptase to build DNA from its RNA molecules?
A. retrovirus
B. reverse virus
C.retro transcriptase
Answers
Answer:
The virus that relies on molecules called reverse transcriptase to build DNA from its RNA molecules is RetroVirus.
Explanation:
Retrovirus is a type of virus that is made up of RNA. When it attacks a cell, RNA is inserted into the host cell. Retrovirus has a special enzyme called reverse transcriptase that is used to create DNA by using RNA as template. It inserts its RNA into host genome and changes the genetic information.
One of the problems associated with the “green revolution” is that (A) not enough food is produced for developing countries. (B) it is confined to highly developed countries. (C) it makes developing countries dependent on high-energy consuming imported technologies. (D) it has been rejected by developing countries due to conflicts with customary practices. (E) technology is not advanced enough to make it cost effective.
Answers
Answer: It would be a
Explanation:
ik because i got it right
Some steps in cell division are shown below:
1. Chromosomes condense and pair up
2. Segments of DNA of sister chromatids twist and cross
3. Exchange of DNA occurs between chromosomes
4. Four daughter cells are created that are haploid
Which of the following steps is least likely to occur during meiosis 1?
Step 1
Step 2
Step 3
Step 4
Answers
Answer:
Step 4
Explanation:
Bcoz only 2 haploid cells are formed at the end of meiosis 1st...at the end of meiosis 2nd.. 4 haploid cells formed
Answer:
The correct answer would be step 4.
Meiosis I is the reduction division which results in the formation of two haploid daughter cells from a single parent cell.
It includes prophase I, metaphase I, anaphase I, and telophase I.
During prophase I, first DNA gets condense to form chromosomes. Each chromosome consists of two sister chromatids. Then the event of crossing-over (exchange of genetic material) takes place.
By the end of meiosis I, the homologous chromosomes are separated into two daughter cells.
Meiosis II results in the formation of four haploid daughter cells.
12. If an ecologist is looking at how many individual organisms live within a certain population, he or she is studying the population
A. interactions.
B. range.
C. density.
D. dynamics.
Answers
The answer would be C or Population Density
Answer: C. density.
Explanation:
Population density can be define as the number of individuals of the population of a species living in a particular area over a concerned time. It is affected by the death, birth, immigration and migration of the members of the concerned population.
On the basis of the above description, this can be concluded that the ecologist is looking for the population density.
An unknown mineral scratches apatite and is scratched by corundum. What can you conclude about this mineral’s hardness?
Answers
If we guide ourselves with the Moh´s scale:
Material scratches apatite → material is harder than 5.
Material is scratched by corundum → material is softer than 9.
Conclusion:
The hardness of the unknown material stands between 5 and 9.
Note:
Both apatite and corundum are defining materials (reference materials in the Moh´s scale). So, you can also give an answer using defining materials:
"It can either be an orthoclase feldspar, a quartz or a topaz".
Hope it helped,
BiologiaMagister
This answer is dedicated to JaySL
According to the question, you can conclude that the hardness of the unknown mineral significantly stands between 5 and 9 on the Moh's Scale.
What is the hardness of apatite and corundum?On Moh's scale, the hardness of apatite is found to be 5, while the hardness of corundum is found to be 9. Apatite is scratched with a knife with difficulty, while corundum is not able to scratch by a knife, because it has a high level of hardness.
It is found that if any mineral scratches apatite, this material will surely have a hardness of more than 5. While if any mineral scratches corundum, this material will surely have a softness than 9.
Corundum is an aluminum oxide that commonly forms hexagonal barrel-shaped prisms that taper at both ends or as thin tabular hexagonal plates. It has a hardness of 9 on the Mohs scale,
Therefore, you can conclude that the hardness of the unknown mineral significantly stands between 5 and 9 on the Moh's Scale.
To learn more about Hardness of mineral, refer to the link:
https://brainly.com/question/18152739
#SPJ6
Which fat has only single bonds between the carbon atoms in the fatty acid
Answers
Answer:
saturated
Explanation:
Answer:
Saturated.
Explanation:
If carbon atoms are bonded with each other by single bond, then they are saturated. But if they are bonded by double or tripla bond, then they are called as un saturated.
What problems would you expect to observe in an ecosystem without producers?
Answers
hi! producers are the main source of energy for consumers because they turn sunlight into chemical energy. without producers, no ecosystem would be able to survive because consumers would no longer have energy needed to live. hope this helps!
Why is it important for an organism to maintain homeostasis
Answers
Answer:
If not they could die.
Explanation:
Some organisms cannot survive in harsh weather conditions so they must balance homeostasis to survive.
Maintaining homeostasis is essential for an organism's survival. It serves to keep internal conditions optimal and stable, regardless of external changes. Disruption of homeostasis can lead to disease.
Explanation:It's crucial for an organism to maintain homeostasis to ensure optimal and stable conditions within its internal environment, regardless of external changes. Homeostasis involves multiple processes that keep conditions within certain boundaries, or set points, to allow the organism to function effectively. For instance, humans maintain a body temperature of approximately 37 degrees Celsius, despite the influence of external temperatures. Similar processes control glucose levels, water balance, and pH balance in the blood. Failure to maintain homeostasis can lead to disease or, in severe cases, death.
Learn more about Homeostasis here:https://brainly.com/question/31789146
#SPJ6
The great variety of biology careers available in _____ allows present-day biologists to follow their personal interests into very specialized fields.
medicine, environmental, and related private industries
terrorism and warfare
palynology and anthropology
physics and chemistry
Answers
Answer:medicine, environmental, and related private industries
Explanation:
For a virus, what advantages and disadvantages does the lytic lifecycle have compared with the lysogenic lifecycle?
A. The lytic lifecycle allows viruses to reproduce more quickly but also kills the host and forces the virus to find a new host cell. B. The lytic lifecycle allows viruses to reproduce when the host cell reproduces, spreading to its daughter cells, but also gives the host cell more time to detect and fight the virus. C. The lytic lifecycle allows a virus to wait until conditions are optimal before reproducing but also gives the host cell more time to detect and fight the virus. D. The lytic lifecycle ensures that the virus won't be detected by the host cell but also kills the host and forces the virus to find a new host cell.
Answers
Answer:
A. The lytic lifecycle allows viruses to reproduce more quickly but also kills the host and forces the virus to find a new host cell.
Explanation:
The lytic lifestyle of the viruses (e.g. bacteriophage) can be described through the next steps:
attachment and injection into the host cell (e.g.bacterial cell) synthesis of the early virus proteins which break down host's DNA virus uses host's machinery (for the replication, transcription and translation) to produce the rest of its proteins and to form new virus particles. host cell burst and many new virus particles are released.During the lysogenic cycle, virus does not kill the host. It integrated its DNA into host's genome and stays dormant until conditions are optimal for reproduction.
Answer:
A. The lytic lifecycle allows viruses to reproduce more quickly but also kills the host and forces the virus to find a new host cell.
Explanation:
bc it says in the textbook
cid rain throughout the northeast United States has lowered the pH of many ponds and lakes. The lowered pH will eventually result in the death of many aquatic animals. The table shows the pH tolerance levels for water that supports a variety of nine animal species.
What is the mathematical range of the minimum pH levels that supports life for the nine species?
A) 2.5
B) 4.5
C) 5.5
D) 7
Answers
Answer:
The answer is A (2.5)
Explanation:
I looked the question up for you but since there is not a chart I can not give you an accurate explanation. Good luck !
Answer:
a
Explanation:
How does a bony fish use the swim bladder?
Answers
The swim bladder can allow fish to swim to lower depths without flouting upwards.
Mrs. Smith's class has been studying properties of minerals in science. She has a mineral sample and wants to know which mineral it is. She performed a scratch test using her fingernail, a copper penny, glass, and a steel nail. Which property is Mrs. Smith testing? A) cleavage B) color C) hardness D) luster
Answers
The answer is C) hardness
the answer is hardness
What could be achieved by DNA profiling using gel electrophoresis?
Answers
Answer:
Gel electrophoresis is a technique used to separate DNA fragments according to their size. DNA samples are loaded into wells (indentations) at one end of a gel, and an electric current is applied to pull them through the gel. DNA fragments are negatively charged, so they move towards the positive electrode.
What allows for some organisms in a population to have an
increased survival rate over other organisms of the same
species?
Answers
Answer:
Their genetic appearance
Explanation:
Some organisms have a different variety than other organisms of the same species. This is where natural selections come into play. Predators may favor one variety over the other, giving some organisms a increased survival rate.
Hope this helped!!
Final answer:
The increased survival rate in some organisms over others within the same species is attributed to genetic variability, beneficial traits, and natural selection. Mutations lead to new traits and those beneficial for survival and reproduction become more common in the population.
Explanation:
The key factors include genetic variability, the presence of certain beneficial traits, and the process of natural selection. Organisms within a population have genetic differences, and some of these genetic variations result in traits that offer a survival advantage in specific environmental contexts. For example, better camouflage might protect prey species from predators, or a more efficient metabolism may allow for survival in scarce food conditions.
Mutations are changes in the genetic code that can lead to new traits in a population. Beneficial mutations that occur in the gametes can be passed down to offspring, thereby contributing to the evolutionary adaptation of the species. Over time, individuals with advantageous traits tend to survive and reproduce more successfully, which means these traits become more common in the population. This is the essence of natural selection: the differential survival and reproduction of organisms based on their genetic traits.
Need help on checking my answers! The ones circled in yellow are the ones that I believe the answers are. Please and thank you
Answers
Answer:
b) development
Explanation:
A tadpole turns into a frog over it's lifetime. this is called development
HELP ASAP!
Explain what happens to energy that is not used
A) lost energy is transferred as heat energy
B) lost energy disappears
C)unused energy is destroyed
D) unused energy is recycled
Answers
The correct answer would be A. a lot of energy is wasted as heat in reactions. Hope this helps:)
The correct answer is A
12. How is the first loop in the circulatory system
amphibian different from the second loop?
cory system of an adult
Answers
Brings Blood To The Lungs And brings blood to and from the rest of the body
What does variation of traits mean?
Answers
Answer:
Genetic variation refers to differences in the genetic makeup of individuals in a population. Genetic variation is necessary in natural selection. In natural selection, organisms with environmentally selected traits are better able to adapt to the environment and pass on their genes.
Explanation:
intracytoplasmic iron ganuakes can be seen as anither distinct morphologic appearance of copper deficiency true or false
Answers
Answer:true
Explanation:thats true because copper helps in transport of iron from cells and therefore increase in the intracytoplasmic iron may indicate a decrease in copper
Copper is basically maintenaning the iron gradient of the cell and therefore the whole body ,decrease in copper may lead to increased iron accumulation in the cell and less utilization of it as well hence disturbing the process of heme synthesis.
1. A researcher observing an ecosystem lists the factors shown below in the image based on it what is the researcher mostly describing?
A
abiotic factors in an ocean
B
abiotic factors in a prairie
C
biotic factors in a forest
D
biotic factors in a tundra
2. The image below shows runoff causing an increase in the algae populations. What effect does this most likely have on the affected lakes and streams?
A
an increase in water level
B
an increase in water clarity
C
a reduction in dissolved oxygen needed by fish and shellfish
D
a reduction in temperature variations near the water's surface
Answers
Answer: Abiotic factors in an ocean
Explanation: without mincing words, it is pertinent to note that the researcher is relating the interaction of the abiotic factors such as water, soil, wind with the biotic factors found in the water body. this is best in describing a typical ecosystem, which describes the interaction of biotic factors with abiotic factors with their environment. one compliments another, hence; it makes a free-flow ecosystem.
Yo sup??
the answer to the first part is option C ie
abiotic factors in a forest
and answer to the 2nd part is option C ie
reductio in dissolved oxygen needed by fish and shellfish
Hope this helps
18. RNAi is a technique that silences genes by targeting them and degrading their mRNA. How can this technique be used in scientific laboratories?
A. RNAi is observed in nature, but it can't be used in laboratories.
B. RNAi allows scientists to turn off one gene specifically to study its effect.
C. RNAi has been used in laboratories to make bacteria more susceptible to antibiotics, but has limited application in eukaryotic cells.
D. RNAi is a powerful tool for degrading mRNA, but because it doesn't degrade other types of RNA, its use is limited.
Answers
Answer:
B
Explanation:
RNAi is a cellular mechanism for post-transcriptional gene silencing. After transcription of a gene into mRNA, small interfering RNA (siRNA) and microRNA (miRNA) can target the mRNA to form dsRNA. This mRNA then becomes a target of ribonucleases such as the Dicer that break it apart. These mRNA, therefore, do not reach the cytoplasm for translation by ribosomes. This mechanism is hence harnessed and manipulated by scientists to study genes by silencing them.
The correct option is B. RNAi allows scientists to turn off one gene specifically to study its effect.
How can this technique be used in scientific laboratories?RNA interference (RNAi) is indeed a powerful technique used in scientific laboratories to silence or inhibit the expression of specific genes. It involves the introduction of small interfering RNA (siRNA) or short hairpin RNA (shRNA) molecules that are complementary to the target gene's mRNA. These small RNA molecules bind to the mRNA, triggering its degradation or blocking its translation into protein.
By using RNAi, scientists can selectively target and silence the expression of a particular gene of interest. This enables them to study the function of that gene and understand its role in biological processes. By observing the effects of gene silencing, researchers can gain insights into gene function, identify potential therapeutic targets, and investigate disease mechanisms.
So the correct option is b.
Learn more about genes at:
https://brainly.com/question/1480756
#SPJ6
What cycle do the light-independent reactions use to turn carbon dioxide into glucose?
A. Calvin cycle
B. Krebs cycle
C. Electron transport cycle
D. Glycolytic cycle
Answers
The answer is a the Calvin cycle
Calvin cycle is used by light-independent reactions to turn carbon dioxide into glucose. Therefore, option A is correct.
The Calvin cycle is also known as the Calvin-Benson cycle or the dark reaction. It is a series of biochemical reactions that occur in the stroma of chloroplasts during photosynthesis.
The primary function of the Calvin cycle is to convert carbon dioxide (CO2) from the atmosphere into glucose and other organic compounds. It is the second stage of photosynthesis, following the light-dependent reactions that occur in the thylakoid membranes.
Learn more about Calvin cycle, here:
https://brainly.com/question/33360156
#SPJ4
areas with hypoxia are known as __ zones
Answers
The answer is : dead zones.
Answer:
Dead zone.
Explanation:
Hypoxia may be defined as the condition of the reduced level of oxygen in the environment. The hypoxia condition of the sea may occur due to naturally or artificially.
The hypoxia area are commonly known as dead zones. This area leads to the death of most of the marine organism due to the deficiency of the oxygen. Excess nutrients flow in the river causes the more chances of the development of the dead zones.
Thus, the answer is dead zones.